Incidental Mutation 'R4430:Pus7'
ID328557
Institutional Source Beutler Lab
Gene Symbol Pus7
Ensembl Gene ENSMUSG00000057541
Gene Namepseudouridylate synthase 7
Synonyms
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R4430 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location23740648-23783711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23746489 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 521 (Y521H)
Ref Sequence ENSEMBL: ENSMUSP00000123129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119946] [ENSMUST00000131992] [ENSMUST00000148618]
Predicted Effect probably benign
Transcript: ENSMUST00000119946
AA Change: Y521H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113801
Gene: ENSMUSG00000057541
AA Change: Y521H

DomainStartEndE-ValueType
low complexity region 77 99 N/A INTRINSIC
Pfam:TruD 246 641 9e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129848
Predicted Effect probably benign
Transcript: ENSMUST00000131404
SMART Domains Protein: ENSMUSP00000122033
Gene: ENSMUSG00000057541

DomainStartEndE-ValueType
Pfam:TruD 1 184 3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131992
AA Change: Y521H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123129
Gene: ENSMUSG00000057541
AA Change: Y521H

DomainStartEndE-ValueType
low complexity region 77 99 N/A INTRINSIC
Pfam:TruD 239 641 1.3e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147922
Predicted Effect probably benign
Transcript: ENSMUST00000148618
AA Change: Y527H

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114588
Gene: ENSMUSG00000057541
AA Change: Y527H

DomainStartEndE-ValueType
low complexity region 77 99 N/A INTRINSIC
Pfam:TruD 251 647 6.3e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148921
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Pus7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Pus7 APN 5 23746424 critical splice donor site probably null
IGL01690:Pus7 APN 5 23775964 missense probably damaging 1.00
IGL01813:Pus7 APN 5 23760304 splice site probably benign
IGL02257:Pus7 APN 5 23762461 missense probably damaging 1.00
IGL02892:Pus7 APN 5 23754556 missense probably damaging 1.00
ANU18:Pus7 UTSW 5 23746424 critical splice donor site probably null
R0010:Pus7 UTSW 5 23747845 missense probably benign 0.01
R0139:Pus7 UTSW 5 23778092 missense probably damaging 0.99
R0219:Pus7 UTSW 5 23775966 missense possibly damaging 0.48
R1127:Pus7 UTSW 5 23768795 missense probably benign 0.04
R1655:Pus7 UTSW 5 23747800 nonsense probably null
R1795:Pus7 UTSW 5 23741916 missense probably damaging 1.00
R1906:Pus7 UTSW 5 23778211 missense probably damaging 0.98
R4379:Pus7 UTSW 5 23748866 intron probably benign
R4431:Pus7 UTSW 5 23746489 missense probably benign 0.30
R5569:Pus7 UTSW 5 23748834 missense probably benign 0.01
R6854:Pus7 UTSW 5 23768847 synonymous silent
R7051:Pus7 UTSW 5 23775679 missense probably damaging 0.98
R7238:Pus7 UTSW 5 23778452 missense probably benign 0.00
R7278:Pus7 UTSW 5 23752344 missense probably damaging 0.99
R7297:Pus7 UTSW 5 23741910 missense probably damaging 1.00
R7540:Pus7 UTSW 5 23760246 missense probably damaging 0.99
R7650:Pus7 UTSW 5 23760246 missense probably damaging 0.99
X0013:Pus7 UTSW 5 23752275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATTAGCCTTCAAGTACCGC -3'
(R):5'- AGTACTGCTGGGAAGTCTTCTG -3'

Sequencing Primer
(F):5'- AAGTACCGCTTCCCACTCTG -3'
(R):5'- CACGGTTCCTCAGCTAATTAAAG -3'
Posted On2015-07-21