Incidental Mutation 'R4430:Ugt2b37'
ID 328559
Institutional Source Beutler Lab
Gene Symbol Ugt2b37
Ensembl Gene ENSMUSG00000057425
Gene Name UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms 0610033E06Rik
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 87240493-87254804 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87254092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 227 (M227V)
Ref Sequence ENSEMBL: ENSMUSP00000075255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075858]
AlphaFold Q8VCN3
Predicted Effect probably benign
Transcript: ENSMUST00000075858
AA Change: M227V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075255
Gene: ENSMUSG00000057425
AA Change: M227V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 5.5e-256 PFAM
Pfam:Glyco_tran_28_C 328 449 2.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Ugt2b37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Ugt2b37 APN 5 87242481 missense possibly damaging 0.90
IGL00567:Ugt2b37 APN 5 87254074 missense probably damaging 1.00
IGL00787:Ugt2b37 APN 5 87242429 missense probably benign 0.00
IGL01560:Ugt2b37 APN 5 87251839 missense probably damaging 1.00
IGL01617:Ugt2b37 APN 5 87251879 missense probably damaging 1.00
IGL01982:Ugt2b37 APN 5 87242432 missense probably damaging 1.00
IGL02299:Ugt2b37 APN 5 87242315 missense probably benign 0.00
IGL02323:Ugt2b37 APN 5 87250564 splice site probably benign
IGL02326:Ugt2b37 APN 5 87241002 missense probably benign 0.25
IGL02516:Ugt2b37 APN 5 87240882 missense probably damaging 1.00
IGL03285:Ugt2b37 APN 5 87240875 missense probably damaging 1.00
R0076:Ugt2b37 UTSW 5 87254221 missense probably benign 0.31
R0141:Ugt2b37 UTSW 5 87240983 missense probably damaging 1.00
R0312:Ugt2b37 UTSW 5 87250665 missense probably damaging 1.00
R0359:Ugt2b37 UTSW 5 87250584 missense probably benign 0.10
R0523:Ugt2b37 UTSW 5 87251832 missense possibly damaging 0.91
R1938:Ugt2b37 UTSW 5 87240857 missense probably damaging 1.00
R1962:Ugt2b37 UTSW 5 87254334 missense probably damaging 1.00
R2496:Ugt2b37 UTSW 5 87254710 missense probably damaging 0.97
R3704:Ugt2b37 UTSW 5 87242987 missense possibly damaging 0.55
R4825:Ugt2b37 UTSW 5 87250639 missense possibly damaging 0.91
R5043:Ugt2b37 UTSW 5 87251860 nonsense probably null
R5098:Ugt2b37 UTSW 5 87242953 missense probably damaging 1.00
R5174:Ugt2b37 UTSW 5 87251880 missense probably benign 0.00
R5522:Ugt2b37 UTSW 5 87240900 missense probably benign 0.14
R5879:Ugt2b37 UTSW 5 87254406 missense probably benign
R5999:Ugt2b37 UTSW 5 87254177 missense probably benign 0.25
R6374:Ugt2b37 UTSW 5 87242420 missense probably damaging 1.00
R6454:Ugt2b37 UTSW 5 87240977 missense probably damaging 1.00
R6857:Ugt2b37 UTSW 5 87240846 missense probably damaging 0.98
R6875:Ugt2b37 UTSW 5 87242429 missense probably benign 0.00
R6916:Ugt2b37 UTSW 5 87254600 missense probably benign 0.07
R7099:Ugt2b37 UTSW 5 87240989 missense probably benign 0.00
R7239:Ugt2b37 UTSW 5 87254731 missense probably benign
R7470:Ugt2b37 UTSW 5 87254112 missense probably benign 0.24
R7810:Ugt2b37 UTSW 5 87254259 missense probably damaging 1.00
R7841:Ugt2b37 UTSW 5 87250630 missense probably benign 0.05
R7860:Ugt2b37 UTSW 5 87254330 missense probably damaging 1.00
R7861:Ugt2b37 UTSW 5 87242440 nonsense probably null
R8200:Ugt2b37 UTSW 5 87240891 nonsense probably null
R8211:Ugt2b37 UTSW 5 87242376 missense probably benign 0.07
R8282:Ugt2b37 UTSW 5 87254581 missense probably benign 0.01
R8312:Ugt2b37 UTSW 5 87242940 missense probably benign 0.15
R8520:Ugt2b37 UTSW 5 87240855 missense probably benign 0.04
R8688:Ugt2b37 UTSW 5 87242381 missense possibly damaging 0.52
R8695:Ugt2b37 UTSW 5 87242384 missense probably benign 0.00
R8772:Ugt2b37 UTSW 5 87254486 missense probably benign 0.00
R8839:Ugt2b37 UTSW 5 87254556 missense probably damaging 1.00
R9087:Ugt2b37 UTSW 5 87254137 missense probably benign 0.01
R9139:Ugt2b37 UTSW 5 87251777 missense probably benign 0.09
R9424:Ugt2b37 UTSW 5 87254358
R9432:Ugt2b37 UTSW 5 87254187
Predicted Primers PCR Primer
(F):5'- TCAGTACTGATACCGATACCTTCTC -3'
(R):5'- AGTCTTCGCTTCACTGCAG -3'

Sequencing Primer
(F):5'- TGATACCGATACCTTCTCCTATTTG -3'
(R):5'- CGCTTCACTGCAGGTTACAGAATTG -3'
Posted On 2015-07-21