Incidental Mutation 'R4430:Vmn2r22'
ID 328562
Institutional Source Beutler Lab
Gene Symbol Vmn2r22
Ensembl Gene ENSMUSG00000095486
Gene Name vomeronasal 2, receptor 22
Synonyms EG546913
MMRRC Submission 041700-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123609758-123650635 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123637858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000132043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170808]
AlphaFold E9Q7S8
Predicted Effect possibly damaging
Transcript: ENSMUST00000170808
AA Change: T258A

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132043
Gene: ENSMUSG00000095486
AA Change: T258A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 473 1.4e-32 PFAM
Pfam:NCD3G 517 570 2.2e-23 PFAM
Pfam:7tm_3 601 838 1.2e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Vmn2r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r22 APN 6 123638053 missense probably damaging 1.00
IGL01764:Vmn2r22 APN 6 123650420 critical splice donor site probably null
IGL02037:Vmn2r22 APN 6 123649067 missense probably damaging 1.00
IGL02183:Vmn2r22 APN 6 123638004 missense probably damaging 1.00
IGL02335:Vmn2r22 APN 6 123638092 missense probably damaging 0.99
IGL02440:Vmn2r22 APN 6 123637405 missense probably benign 0.00
IGL02663:Vmn2r22 APN 6 123649158 missense probably benign 0.11
IGL03101:Vmn2r22 APN 6 123637336 missense probably benign 0.09
R0266:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R0348:Vmn2r22 UTSW 6 123637725 missense probably damaging 1.00
R0780:Vmn2r22 UTSW 6 123637974 missense probably damaging 1.00
R0849:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R1074:Vmn2r22 UTSW 6 123649258 missense probably benign 0.02
R1456:Vmn2r22 UTSW 6 123637665 missense possibly damaging 0.86
R1719:Vmn2r22 UTSW 6 123637843 missense possibly damaging 0.68
R1989:Vmn2r22 UTSW 6 123637541 missense probably damaging 1.00
R2928:Vmn2r22 UTSW 6 123637443 missense probably damaging 0.96
R2939:Vmn2r22 UTSW 6 123637635 missense probably damaging 0.99
R3727:Vmn2r22 UTSW 6 123650625 missense possibly damaging 0.70
R3782:Vmn2r22 UTSW 6 123650632 nonsense probably null
R3873:Vmn2r22 UTSW 6 123637380 missense possibly damaging 0.68
R4344:Vmn2r22 UTSW 6 123637797 missense probably damaging 1.00
R4407:Vmn2r22 UTSW 6 123637954 missense probably damaging 1.00
R4428:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4431:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4701:Vmn2r22 UTSW 6 123650469 missense probably benign 0.00
R5274:Vmn2r22 UTSW 6 123650634 start codon destroyed probably null 0.93
R5668:Vmn2r22 UTSW 6 123637914 missense probably benign 0.06
R5776:Vmn2r22 UTSW 6 123637714 missense probably damaging 1.00
R6416:Vmn2r22 UTSW 6 123637738 missense probably damaging 1.00
R7788:Vmn2r22 UTSW 6 123637600 missense not run
R8208:Vmn2r22 UTSW 6 123637485 missense probably damaging 1.00
R8267:Vmn2r22 UTSW 6 123638041 missense possibly damaging 0.81
R8400:Vmn2r22 UTSW 6 123637527 nonsense probably null
R8814:Vmn2r22 UTSW 6 123637830 missense probably damaging 0.96
R8850:Vmn2r22 UTSW 6 123637495 missense probably damaging 1.00
R9613:Vmn2r22 UTSW 6 123638116 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCAGAATTTGATCCATGCGATC -3'
(R):5'- ATCAGGGAATTATTCAACTGCTGC -3'

Sequencing Primer
(F):5'- AGAAAATGATAATCCTCCACCAAAG -3'
(R):5'- AACTGCTGCTATACTTCACTTGGG -3'
Posted On 2015-07-21