Incidental Mutation 'R4430:Sox5'
ID328563
Institutional Source Beutler Lab
Gene Symbol Sox5
Ensembl Gene ENSMUSG00000041540
Gene NameSRY (sex determining region Y)-box 5
SynonymsA730017D01Rik
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4430 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location143828425-144781977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144041274 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 188 (I188T)
Ref Sequence ENSEMBL: ENSMUSP00000047567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111749] [ENSMUST00000170367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038815
AA Change: I188T

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: I188T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 431 445 N/A INTRINSIC
coiled coil region 449 483 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HMG 555 625 2.84e-26 SMART
low complexity region 686 708 N/A INTRINSIC
low complexity region 729 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077160
AA Change: I188T

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: I188T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 277 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
coiled coil region 401 435 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
HMG 507 577 2.84e-26 SMART
low complexity region 638 660 N/A INTRINSIC
low complexity region 681 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111749
AA Change: I153T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540
AA Change: I153T

DomainStartEndE-ValueType
low complexity region 132 143 N/A INTRINSIC
coiled coil region 158 237 N/A INTRINSIC
low complexity region 347 361 N/A INTRINSIC
coiled coil region 365 399 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
HMG 471 541 2.84e-26 SMART
low complexity region 602 624 N/A INTRINSIC
low complexity region 645 666 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142294
Predicted Effect probably benign
Transcript: ENSMUST00000170367
AA Change: I188T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: I188T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
coiled coil region 400 434 N/A INTRINSIC
low complexity region 445 456 N/A INTRINSIC
HMG 506 576 2.84e-26 SMART
low complexity region 637 659 N/A INTRINSIC
low complexity region 680 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Sox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Sox5 APN 6 144116472 missense probably damaging 0.96
IGL03217:Sox5 APN 6 143907497 missense probably damaging 1.00
Stocking UTSW 6 144116443 critical splice donor site probably null
R0230:Sox5 UTSW 6 144209338 missense probably benign 0.02
R0610:Sox5 UTSW 6 143833439 missense possibly damaging 0.56
R1162:Sox5 UTSW 6 143960812 missense probably damaging 1.00
R1857:Sox5 UTSW 6 143960815 missense probably damaging 1.00
R1959:Sox5 UTSW 6 143874105 missense possibly damaging 0.94
R4057:Sox5 UTSW 6 144116522 missense probably damaging 1.00
R4164:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R4284:Sox5 UTSW 6 143835329 missense probably damaging 1.00
R4470:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4471:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4672:Sox5 UTSW 6 143833349 missense probably damaging 1.00
R4683:Sox5 UTSW 6 143833467 missense probably damaging 0.99
R4693:Sox5 UTSW 6 143835316 missense probably damaging 1.00
R4735:Sox5 UTSW 6 143960835 missense probably damaging 1.00
R4745:Sox5 UTSW 6 143833488 missense possibly damaging 0.53
R4762:Sox5 UTSW 6 143861383 critical splice donor site probably null
R4996:Sox5 UTSW 6 144028344 nonsense probably null
R5218:Sox5 UTSW 6 143960890 missense possibly damaging 0.93
R5673:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R5856:Sox5 UTSW 6 144209362 missense probably damaging 1.00
R6249:Sox5 UTSW 6 143833283 missense probably benign 0.33
R6394:Sox5 UTSW 6 144041313 missense probably damaging 1.00
R6703:Sox5 UTSW 6 143833465 missense probably damaging 1.00
R6812:Sox5 UTSW 6 144116443 critical splice donor site probably null
R7312:Sox5 UTSW 6 144155033 missense probably benign
R7543:Sox5 UTSW 6 143841179 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGACAGACTGGGTTTGTGC -3'
(R):5'- ACCAGGATAGCCTATTCTTAGCAG -3'

Sequencing Primer
(F):5'- TTGGTCCTATACACTGCAAGCGG -3'
(R):5'- CTTAGCAGATAGGCTTCTATGAGCC -3'
Posted On2015-07-21