Mutagenetix > Incidental Mutations

Incidental Mutation 'R4430:Ssc5d'

328564

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

041700-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4430 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4943664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1006 (S1006P)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably benign
Transcript: ENSMUST00000057612
AA Change: S1006P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: S1006P

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207310

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Aak1	A	G	6: 86,986,366	N926S	unknown	Het
Ahi1	T	A	10: 20,972,078	C462S	probably damaging	Het
Ahnak	A	G	19: 9,003,040	I563V	probably benign	Het
Ankrd55	G	A	13: 112,323,183		probably null	Het
Bag3	A	G	7: 128,523,923	D22G	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Col15a1	T	C	4: 47,245,705	F152S	probably damaging	Het
Cxcr2	T	C	1: 74,158,845	I166T	probably benign	Het
Dnah11	T	C	12: 117,983,011	I3113V	probably benign	Het
Gli2	T	C	1: 118,837,244	H1059R	probably benign	Het
Gm14412	C	A	2: 177,315,832	S90I	probably benign	Het
L1td1	A	G	4: 98,737,151	R528G	probably benign	Het
Mcm3	A	T	1: 20,811,993	L449*	probably null	Het
Mif4gd	T	C	11: 115,608,502	T185A	probably benign	Het
Mphosph9	T	C	5: 124,265,446	S840G	possibly damaging	Het
Nim1k	C	A	13: 119,712,542	R272L	possibly damaging	Het
Olfr1079	A	G	2: 86,538,387	I176T	probably damaging	Het
Olfr1457	C	T	19: 13,095,088	V187I	probably benign	Het
Olfr806	T	A	10: 129,738,261	I219F	probably damaging	Het
Pax3	A	G	1: 78,195,324	V83A	probably damaging	Het
Pde3b	C	T	7: 114,534,670	P974S	probably damaging	Het
Pdzd3	C	T	9: 44,249,744	S175N	probably benign	Het
Pglyrp3	T	A	3: 92,031,491	D324E	probably damaging	Het
Pus7	A	G	5: 23,746,489	Y521H	probably benign	Het
Ryr2	A	G	13: 11,735,527	S1953P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sox5	A	G	6: 144,041,274	I188T	possibly damaging	Het
Spata4	T	C	8: 54,601,843	I86T	probably benign	Het
Stk10	T	C	11: 32,533,552	V50A	possibly damaging	Het
Sytl4	A	G,T	X: 133,949,223	S338R	probably damaging	Homo
Sytl5	A	T	X: 9,960,023	N412Y	probably damaging	Het
Tert	T	A	13: 73,627,475	F115Y	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem201	A	C	4: 149,731,139	V118G	probably benign	Het
Tmem67	T	A	4: 12,051,473	N785I	possibly damaging	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Ugt2b37	T	C	5: 87,254,092	M227V	probably benign	Het
Vmn2r22	T	C	6: 123,637,858	T258A	possibly damaging	Het
Vmn2r73	A	T	7: 85,870,241	M503K	probably benign	Het
Zfp54	T	G	17: 21,434,960	V572G	probably damaging	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1801:Ssc5d	UTSW	7	4936607	missense	probably benign	0.05
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2084:Ssc5d	UTSW	7	4937012	missense	probably benign	0.01
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2567:Ssc5d	UTSW	7	4936335	missense	probably damaging	1.00
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5553:Ssc5d	UTSW	7	4936290	missense	probably damaging	1.00
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6332:Ssc5d	UTSW	7	4937522	missense	probably damaging	1.00
R6341:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R8480:Ssc5d	UTSW	7	4936329	missense	probably damaging	1.00
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGCGGAATACGTAGATAGGGC -3'
(R):5'- GAGAAAGCCTGCTCACTTCTG -3'

Sequencing Primer
(F):5'- TACGTAGATAGGGCAATAGGGC -3'
(R):5'- CTGCTCACTTCTGATAGCATAGAGG -3'

Posted On

2015-07-21