Incidental Mutation 'R4430:Bag3'
ID 328567
Institutional Source Beutler Lab
Gene Symbol Bag3
Ensembl Gene ENSMUSG00000030847
Gene Name BCL2-associated athanogene 3
Synonyms Bcl-2-interacting death suppressor, Bis
MMRRC Submission 041700-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4430 (G1)
Quality Score 198
Status Not validated
Chromosome 7
Chromosomal Location 128523616-128546981 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128523923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000033136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033136]
AlphaFold Q9JLV1
PDB Structure Solution structure of the Murine BAG domain of Bcl2-associated athanogene 3 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000033136
AA Change: D22G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033136
Gene: ENSMUSG00000030847
AA Change: D22G

DomainStartEndE-ValueType
WW 23 56 1.49e-11 SMART
internal_repeat_1 90 151 3.37e-5 PROSPERO
low complexity region 158 171 N/A INTRINSIC
low complexity region 176 204 N/A INTRINSIC
internal_repeat_1 206 283 3.37e-5 PROSPERO
low complexity region 372 392 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
BAG 426 503 9.22e-27 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, growth retardation, cardiomyocyte and skeletal myocyte degeneration, and pulmonary edema. Mice homozygous for a null allele also exhibit postnatal lethality and growth retardation but lack the myocyte degeneration phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Bag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Bag3 APN 7 128546341 missense probably benign 0.03
IGL01942:Bag3 APN 7 128546300 missense probably benign 0.00
PIT4377001:Bag3 UTSW 7 128545717 missense probably damaging 1.00
R0577:Bag3 UTSW 7 128523887 missense probably benign 0.00
R1730:Bag3 UTSW 7 128523859 start codon destroyed possibly damaging 0.89
R1991:Bag3 UTSW 7 128545683 missense probably benign
R2065:Bag3 UTSW 7 128545774 missense probably damaging 0.96
R2198:Bag3 UTSW 7 128545769 frame shift probably null
R2201:Bag3 UTSW 7 128545769 frame shift probably null
R3407:Bag3 UTSW 7 128545768 frame shift probably null
R3407:Bag3 UTSW 7 128545769 frame shift probably null
R3408:Bag3 UTSW 7 128545769 frame shift probably null
R3765:Bag3 UTSW 7 128540271 missense probably benign 0.30
R4201:Bag3 UTSW 7 128546157 missense probably damaging 1.00
R5642:Bag3 UTSW 7 128546106 missense probably damaging 1.00
R6112:Bag3 UTSW 7 128541832 missense probably damaging 0.99
R6298:Bag3 UTSW 7 128540198 missense probably damaging 0.99
R8145:Bag3 UTSW 7 128545888 missense possibly damaging 0.71
R9216:Bag3 UTSW 7 128542199 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATTCATAAAGGTGCCCGGC -3'
(R):5'- CGGATATGGTTAAGGACTCTCC -3'

Sequencing Primer
(F):5'- ATCGGCTACACAGAGGT -3'
(R):5'- TGGGGTGACTCGCATAGC -3'
Posted On 2015-07-21