Incidental Mutation 'R4430:Olfr806'
ID 328572
Institutional Source Beutler Lab
Gene Symbol Olfr806
Ensembl Gene ENSMUSG00000071065
Gene Name olfactory receptor 806
Synonyms MOR110-5, MOR110-12, GA_x6K02T2PULF-11417610-11416669
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129735571-129741921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129738261 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 219 (I219F)
Ref Sequence ENSEMBL: ENSMUSP00000150380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095245] [ENSMUST00000213239] [ENSMUST00000215142]
AlphaFold Q8VFI2
Predicted Effect probably damaging
Transcript: ENSMUST00000095245
AA Change: I219F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092873
Gene: ENSMUSG00000071065
AA Change: I219F

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 2.6e-52 PFAM
Pfam:7tm_1 39 288 4.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204624
AA Change: I219F
SMART Domains Protein: ENSMUSP00000144955
Gene: ENSMUSG00000071065
AA Change: I219F

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 2.6e-52 PFAM
Pfam:7tm_1 39 288 4.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213239
AA Change: I219F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215142
AA Change: I219F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Olfr806
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Olfr806 APN 10 129738922 utr 5 prime probably benign
IGL02090:Olfr806 APN 10 129738312 missense probably benign
IGL02328:Olfr806 APN 10 129738026 missense probably benign 0.35
IGL02572:Olfr806 APN 10 129738866 missense possibly damaging 0.81
R1773:Olfr806 UTSW 10 129738443 missense probably damaging 0.97
R1797:Olfr806 UTSW 10 129738709 missense probably benign 0.03
R5704:Olfr806 UTSW 10 129738816 missense probably benign 0.00
R6140:Olfr806 UTSW 10 129738654 missense possibly damaging 0.95
R6655:Olfr806 UTSW 10 129738087 missense possibly damaging 0.96
R6858:Olfr806 UTSW 10 129738464 missense probably damaging 1.00
R7647:Olfr806 UTSW 10 129738201 missense probably damaging 0.99
R7879:Olfr806 UTSW 10 129738690 missense probably benign 0.15
R8392:Olfr806 UTSW 10 129738041 missense probably damaging 1.00
R8510:Olfr806 UTSW 10 129738185 missense probably benign 0.01
R8765:Olfr806 UTSW 10 129738642 missense probably damaging 1.00
R8774:Olfr806 UTSW 10 129738057 missense probably damaging 1.00
R8774-TAIL:Olfr806 UTSW 10 129738057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTGCTGGTTCCTTAGG -3'
(R):5'- CTCAAACTGGAATTCTGTGCTTCC -3'

Sequencing Primer
(F):5'- CCACAGAGGTGTTGAGCAC -3'
(R):5'- CTGTGCTTCCAAAACTGTAGATCAC -3'
Posted On 2015-07-21