Mutagenetix > Incidental Mutations

Incidental Mutation 'R4430:Sost'

328574

Institutional Source

Beutler Lab

Gene Symbol

Sost

Ensembl Gene

ENSMUSG00000001494

Gene Name

sclerostin

Synonyms

5430411E23Rik

MMRRC Submission

041700-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R4430 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101962458-101967015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 101966844 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 44 (P44S)

Ref Sequence

ENSEMBL: ENSMUSP00000001534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001534] [ENSMUST00000003612] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000151678]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001534
AA Change: P44S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000001534
Gene: ENSMUSG00000001494
AA Change: P44S

Domain	Start	End	E-Value	Type
Pfam:Sclerostin	1	208	8e-98	PFAM
Pfam:DAN	51	168	1.2e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000003612

SMART Domains

Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

Domain	Start	End	E-Value	Type
DSPc	29	176	8.04e-58	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107172

SMART Domains

Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

Domain	Start	End	E-Value	Type
DSPc	29	176	8.04e-58	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107173

SMART Domains

Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

Domain	Start	End	E-Value	Type
DSPc	54	201	8.04e-58	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151678

SMART Domains

Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

Domain	Start	End	E-Value	Type
DSPc	3	108	6.99e-26	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176599

Meta Mutation Damage Score

0.3937

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase in trabecular and cortical bone volume, mineral density, and formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Aak1	A	G	6: 86,986,366	N926S	unknown	Het
Ahi1	T	A	10: 20,972,078	C462S	probably damaging	Het
Ahnak	A	G	19: 9,003,040	I563V	probably benign	Het
Ankrd55	G	A	13: 112,323,183		probably null	Het
Bag3	A	G	7: 128,523,923	D22G	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Col15a1	T	C	4: 47,245,705	F152S	probably damaging	Het
Cxcr2	T	C	1: 74,158,845	I166T	probably benign	Het
Dnah11	T	C	12: 117,983,011	I3113V	probably benign	Het
Gli2	T	C	1: 118,837,244	H1059R	probably benign	Het
Gm14412	C	A	2: 177,315,832	S90I	probably benign	Het
L1td1	A	G	4: 98,737,151	R528G	probably benign	Het
Mcm3	A	T	1: 20,811,993	L449*	probably null	Het
Mif4gd	T	C	11: 115,608,502	T185A	probably benign	Het
Mphosph9	T	C	5: 124,265,446	S840G	possibly damaging	Het
Nim1k	C	A	13: 119,712,542	R272L	possibly damaging	Het
Olfr1079	A	G	2: 86,538,387	I176T	probably damaging	Het
Olfr1457	C	T	19: 13,095,088	V187I	probably benign	Het
Olfr806	T	A	10: 129,738,261	I219F	probably damaging	Het
Pax3	A	G	1: 78,195,324	V83A	probably damaging	Het
Pde3b	C	T	7: 114,534,670	P974S	probably damaging	Het
Pdzd3	C	T	9: 44,249,744	S175N	probably benign	Het
Pglyrp3	T	A	3: 92,031,491	D324E	probably damaging	Het
Pus7	A	G	5: 23,746,489	Y521H	probably benign	Het
Ryr2	A	G	13: 11,735,527	S1953P	probably damaging	Het
Sox5	A	G	6: 144,041,274	I188T	possibly damaging	Het
Spata4	T	C	8: 54,601,843	I86T	probably benign	Het
Ssc5d	T	C	7: 4,943,664	S1006P	probably benign	Het
Stk10	T	C	11: 32,533,552	V50A	possibly damaging	Het
Sytl4	A	G,T	X: 133,949,223	S338R	probably damaging	Homo
Sytl5	A	T	X: 9,960,023	N412Y	probably damaging	Het
Tert	T	A	13: 73,627,475	F115Y	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem201	A	C	4: 149,731,139	V118G	probably benign	Het
Tmem67	T	A	4: 12,051,473	N785I	possibly damaging	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Ugt2b37	T	C	5: 87,254,092	M227V	probably benign	Het
Vmn2r22	T	C	6: 123,637,858	T258A	possibly damaging	Het
Vmn2r73	A	T	7: 85,870,241	M503K	probably benign	Het
Zfp54	T	G	17: 21,434,960	V572G	probably damaging	Het

Other mutations in Sost

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Sost	APN	11	101966879	missense	probably damaging	1.00
IGL02487:Sost	APN	11	101966807	missense	possibly damaging	0.64
IGL02967:Sost	APN	11	101964258	missense	possibly damaging	0.50
R0724:Sost	UTSW	11	101966918	missense	probably benign	0.04
R1873:Sost	UTSW	11	101964243	missense	probably damaging	1.00
R2182:Sost	UTSW	11	101963850	missense	probably damaging	1.00
R3429:Sost	UTSW	11	101964039	missense	probably damaging	1.00
R4428:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R4464:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R4537:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R4539:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R4540:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R4541:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R4542:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R4710:Sost	UTSW	11	101966844	missense	probably damaging	0.97
R5125:Sost	UTSW	11	101963941	missense	probably damaging	1.00
R7297:Sost	UTSW	11	101964103	missense	probably damaging	1.00
R7779:Sost	UTSW	11	101966849	missense	possibly damaging	0.75
RF013:Sost	UTSW	11	101964132	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATGTGTCCCTGCCCTGATG -3'
(R):5'- AACCGTATCTAGGCTGGACAC -3'

Sequencing Primer
(F):5'- TGCCCTGATGTAGCAGAGG -3'
(R):5'- TATCTAGGCTGGACACTGGAGC -3'

Posted On

2015-07-21