Incidental Mutation 'R4430:Mif4gd'
ID 328575
Institutional Source Beutler Lab
Gene Symbol Mif4gd
Ensembl Gene ENSMUSG00000020743
Gene Name MIF4G domain containing
Synonyms
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 115607918-115612969 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115608502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 185 (T185A)
Ref Sequence ENSEMBL: ENSMUSP00000102116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021087] [ENSMUST00000058109] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000106508] [ENSMUST00000125097] [ENSMUST00000156173] [ENSMUST00000148574]
AlphaFold Q3UBZ5
Predicted Effect probably benign
Transcript: ENSMUST00000019135
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021087
AA Change: T185A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743
AA Change: T185A

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058109
SMART Domains Protein: ENSMUSP00000053033
Gene: ENSMUSG00000046756

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_S7 68 234 7.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106506
AA Change: T166A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743
AA Change: T166A

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106507
AA Change: T185A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743
AA Change: T185A

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106508
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124407
Predicted Effect probably benign
Transcript: ENSMUST00000125097
SMART Domains Protein: ENSMUSP00000118024
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
Pfam:VHS 3 106 3.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149814
Predicted Effect probably benign
Transcript: ENSMUST00000156173
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148574
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminus of the stem-loop binding protein (SLBP) and the 3' end of histone mRNA. This interaction facilitates the activation of histone mRNA translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Mif4gd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0135:Mif4gd UTSW 11 115608465 missense probably damaging 1.00
R4588:Mif4gd UTSW 11 115609546 missense probably damaging 1.00
R4656:Mif4gd UTSW 11 115608337 unclassified probably benign
R4947:Mif4gd UTSW 11 115609637 missense probably benign 0.01
R5890:Mif4gd UTSW 11 115609362 missense probably benign 0.03
R5935:Mif4gd UTSW 11 115609613 missense probably benign 0.18
R6527:Mif4gd UTSW 11 115609275 splice site probably null
R7106:Mif4gd UTSW 11 115611911 missense probably damaging 1.00
R7515:Mif4gd UTSW 11 115608396 missense possibly damaging 0.50
R8463:Mif4gd UTSW 11 115608498 missense probably benign 0.02
X0067:Mif4gd UTSW 11 115609584 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAAGCAAGGATTCTGGTG -3'
(R):5'- TTGGTGTCAGAATGGAGCGC -3'

Sequencing Primer
(F):5'- ATTCTGGTGCCAGCTTGAAAAG -3'
(R):5'- TCAGAATGGAGCGCGGTACTC -3'
Posted On 2015-07-21