Incidental Mutation 'R4430:Nim1k'
ID 328580
Institutional Source Beutler Lab
Gene Symbol Nim1k
Ensembl Gene ENSMUSG00000095930
Gene Name NIM1 serine/threonine protein kinase
Synonyms E130304F04Rik, Nim1
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 119710094-119755882 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 119712542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 272 (R272L)
Ref Sequence ENSEMBL: ENSMUSP00000136377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178142] [ENSMUST00000179869] [ENSMUST00000224188]
AlphaFold Q8BHI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000178142
AA Change: R272L

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136377
Gene: ENSMUSG00000095930
AA Change: R272L

DomainStartEndE-ValueType
S_TKc 74 325 8.66e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179869
SMART Domains Protein: ENSMUSP00000136944
Gene: ENSMUSG00000093930

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 13 186 4e-111 PFAM
Pfam:HMG_CoA_synt_C 187 469 4e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224188
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Nim1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1334:Nim1k UTSW 13 119712488 missense probably benign 0.05
R1782:Nim1k UTSW 13 119712151 missense probably benign 0.00
R2216:Nim1k UTSW 13 119714215 missense probably damaging 0.99
R3710:Nim1k UTSW 13 119712099 missense probably benign
R4385:Nim1k UTSW 13 119712626 missense probably damaging 0.98
R4484:Nim1k UTSW 13 119712174 nonsense probably null
R4812:Nim1k UTSW 13 119712384 missense probably benign
R5383:Nim1k UTSW 13 119727799 missense probably benign 0.25
R5436:Nim1k UTSW 13 119727529 intron probably benign
R5511:Nim1k UTSW 13 119727594 missense probably damaging 1.00
R6682:Nim1k UTSW 13 119712188 missense probably benign 0.09
R6922:Nim1k UTSW 13 119727727 missense probably damaging 0.99
R7053:Nim1k UTSW 13 119727609 missense probably damaging 1.00
R7455:Nim1k UTSW 13 119712459 missense probably damaging 1.00
R8168:Nim1k UTSW 13 119712752 missense probably damaging 1.00
R8333:Nim1k UTSW 13 119712486 missense probably damaging 1.00
R8401:Nim1k UTSW 13 119712677 missense probably damaging 1.00
R8411:Nim1k UTSW 13 119714271 missense possibly damaging 0.95
R8515:Nim1k UTSW 13 119712450 nonsense probably null
R8540:Nim1k UTSW 13 119714182 missense probably benign 0.34
R8915:Nim1k UTSW 13 119712338 missense probably benign 0.10
R9227:Nim1k UTSW 13 119712582 missense probably damaging 1.00
R9416:Nim1k UTSW 13 119727826 missense probably benign
Z1177:Nim1k UTSW 13 119727702 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGACAAATGTTTGGGATCCAG -3'
(R):5'- GGGAGATTTTGGATTCAGCAC -3'

Sequencing Primer
(F):5'- CAAATGTTTGGGATCCAGTTGGAAC -3'
(R):5'- GAGATTTTGGATTCAGCACAGTAAG -3'
Posted On 2015-07-21