Incidental Mutation 'R4430:Sytl5'
ID328587
Institutional Source Beutler Lab
Gene Symbol Sytl5
Ensembl Gene ENSMUSG00000054453
Gene Namesynaptotagmin-like 5
SynonymsENSMUSG00000054453
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4430 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location9885622-9994543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9960023 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 412 (N412Y)
Ref Sequence ENSEMBL: ENSMUSP00000064826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067529] [ENSMUST00000086165]
Predicted Effect probably damaging
Transcript: ENSMUST00000067529
AA Change: N412Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064826
Gene: ENSMUSG00000054453
AA Change: N412Y

DomainStartEndE-ValueType
Pfam:FYVE_2 11 124 6.9e-21 PFAM
low complexity region 224 237 N/A INTRINSIC
low complexity region 313 332 N/A INTRINSIC
C2 445 549 1.51e-15 SMART
low complexity region 593 610 N/A INTRINSIC
C2 611 728 1.86e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086165
AA Change: N390Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083339
Gene: ENSMUSG00000054453
AA Change: N390Y

DomainStartEndE-ValueType
Pfam:FYVE_2 11 124 2.1e-21 PFAM
low complexity region 224 237 N/A INTRINSIC
low complexity region 313 332 N/A INTRINSIC
C2 423 527 1.51e-15 SMART
low complexity region 571 588 N/A INTRINSIC
C2 589 706 1.86e-15 SMART
Meta Mutation Damage Score 0.2006 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays a role in protein transport. Expression of this gene is restricted to placenta and liver, suggesting that it might be involved in Rab27A-dependent membrane trafficking in specific tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Sytl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Sytl5 APN X 9905595 missense probably benign
IGL02072:Sytl5 APN X 9963586 splice site probably benign
IGL03366:Sytl5 APN X 9963700 missense probably damaging 1.00
H8562:Sytl5 UTSW X 9960096 missense probably benign 0.35
R0729:Sytl5 UTSW X 9994497 missense probably damaging 1.00
R4429:Sytl5 UTSW X 9960023 missense probably damaging 1.00
R4431:Sytl5 UTSW X 9960023 missense probably damaging 1.00
R4910:Sytl5 UTSW X 9915602 missense possibly damaging 0.51
R4911:Sytl5 UTSW X 9915602 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTTTCAGCAAACGTCCTGCC -3'
(R):5'- TGACAAGGAAGTGTGCATGC -3'

Sequencing Primer
(F):5'- CCTTTCCTAATGGATCTACATGGGG -3'
(R):5'- GGGCATCCTCCGTGCTTAC -3'
Posted On2015-07-21