Incidental Mutation 'R4431:2510039O18Rik'
ID328604
Institutional Source Beutler Lab
Gene Symbol 2510039O18Rik
Ensembl Gene ENSMUSG00000044496
Gene NameRIKEN cDNA 2510039O18 gene
Synonyms
MMRRC Submission 041146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R4431 (G1)
Quality Score170
Status Validated
Chromosome4
Chromosomal Location147940895-147947314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147941565 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 181 (S181P)
Ref Sequence ENSEMBL: ENSMUSP00000099522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019199] [ENSMUST00000103232] [ENSMUST00000105712]
Predicted Effect probably benign
Transcript: ENSMUST00000019199
SMART Domains Protein: ENSMUSP00000019199
Gene: ENSMUSG00000019055

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Blast:P4Hc 444 492 1e-8 BLAST
P4Hc 554 727 4.87e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103232
AA Change: S181P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099522
Gene: ENSMUSG00000044496
AA Change: S181P

DomainStartEndE-ValueType
Pfam:DUF2152 6 629 2.9e-251 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105712
SMART Domains Protein: ENSMUSP00000101337
Gene: ENSMUSG00000019055

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132075
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930522L14Rik A T 5: 109,736,574 C473S possibly damaging Het
4930523C07Rik A T 1: 160,044,579 noncoding transcript Het
9230110C19Rik A G 9: 8,027,177 V120A probably damaging Het
Aak1 A G 6: 86,986,318 K910R unknown Het
Abca2 A G 2: 25,442,852 D1521G probably benign Het
Adamts20 C A 15: 94,344,043 D695Y probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bspry T A 4: 62,482,667 I132N possibly damaging Het
Cfh T C 1: 140,136,266 Y424C probably damaging Het
Chd2 T C 7: 73,435,961 R1642G possibly damaging Het
Chrm2 A G 6: 36,524,162 D318G probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fbxo42 C A 4: 141,200,550 R714S probably damaging Het
Fmo1 G A 1: 162,833,712 A334V possibly damaging Het
Gpr68 A T 12: 100,899,391 probably benign Het
Gramd4 A G 15: 86,130,160 K345R probably damaging Het
Gtpbp1 T G 15: 79,716,197 S444A probably damaging Het
Ints12 T C 3: 133,102,481 Y207H probably damaging Het
Kat2b-ps A T 5: 93,392,584 noncoding transcript Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Lamc1 A G 1: 153,221,528 I1590T probably damaging Het
Lhfpl4 A G 6: 113,193,844 I127T possibly damaging Het
Lrrc71 A G 3: 87,742,836 S286P possibly damaging Het
Man1c1 A T 4: 134,703,018 V151D probably damaging Het
Mipol1 G A 12: 57,303,524 R36Q possibly damaging Het
Nuggc T A 14: 65,611,210 W187R probably benign Het
Olfr1243 A G 2: 89,527,643 Y256H probably damaging Het
Pkhd1 G A 1: 20,523,314 T1525I probably damaging Het
Pomp A G 5: 147,875,479 E125G probably damaging Het
Ptar1 G T 19: 23,694,331 G33C probably damaging Het
Ptpn3 A G 4: 57,235,355 S335P probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Shank1 C T 7: 44,319,652 R324* probably null Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slc12a9 G A 5: 137,321,513 P580L probably benign Het
Spz1 A G 13: 92,575,329 L213P probably damaging Het
Strn A G 17: 78,736,462 V9A probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trf T C 9: 103,211,876 N243S possibly damaging Het
Ttc3 T C 16: 94,410,958 probably null Het
Uhrf1bp1 A G 17: 27,885,931 N533S probably damaging Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vps13b A C 15: 35,770,753 Q2114P probably damaging Het
Wdfy1 T A 1: 79,713,866 R275* probably null Het
Wnt2b A G 3: 104,952,940 L217S probably damaging Het
Other mutations in 2510039O18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:2510039O18Rik APN 4 147945064 missense probably damaging 1.00
R1135:2510039O18Rik UTSW 4 147944658 missense probably benign 0.26
R1546:2510039O18Rik UTSW 4 147941775 missense probably damaging 0.97
R2008:2510039O18Rik UTSW 4 147941577 missense probably benign 0.31
R2437:2510039O18Rik UTSW 4 147946618 makesense probably null
R3937:2510039O18Rik UTSW 4 147942053 missense possibly damaging 0.54
R3970:2510039O18Rik UTSW 4 147945322 missense probably damaging 0.99
R3973:2510039O18Rik UTSW 4 147945031 missense probably damaging 1.00
R3974:2510039O18Rik UTSW 4 147945031 missense probably damaging 1.00
R4050:2510039O18Rik UTSW 4 147944992 missense probably damaging 1.00
R4750:2510039O18Rik UTSW 4 147941488 missense probably damaging 0.99
R4943:2510039O18Rik UTSW 4 147945098 missense probably damaging 1.00
R5139:2510039O18Rik UTSW 4 147945448 missense probably damaging 0.98
R6735:2510039O18Rik UTSW 4 147941817 missense probably benign
R7139:2510039O18Rik UTSW 4 147941838 missense possibly damaging 0.90
R7689:2510039O18Rik UTSW 4 147944983 missense probably damaging 1.00
R8307:2510039O18Rik UTSW 4 147941380 missense probably benign 0.00
V5088:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
V5622:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
V5622:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
Z1088:2510039O18Rik UTSW 4 147944745 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCCAACAACCGGCTGTG -3'
(R):5'- TCTCCAGGGTGCTGGTGAAG -3'

Sequencing Primer
(F):5'- GGACTTCGTGCCCTTCGTG -3'
(R):5'- AAGGATTTGGGGACTGGGCC -3'
Posted On2015-07-21