Incidental Mutation 'R0044:Dido1'
ID 32861
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Name death inducer-obliterator 1
Synonyms 6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission 038338-MU
Accession Numbers

Genbank: NM_175551; MGI: 1344352
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock # R0044 (G1)
Quality Score 213
Status Validated (trace)
Chromosome 2
Chromosomal Location 180657964-180709999 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 180661819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1431 (A1431T)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517]
AlphaFold Q8C9B9
Predicted Effect probably damaging
Transcript: ENSMUST00000087517
AA Change: A1431T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: A1431T

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430571L13Rik A C 9: 107,342,499 R50S probably damaging Het
Actn2 G T 13: 12,275,127 T176N possibly damaging Het
Adamts7 T C 9: 90,171,588 V62A possibly damaging Het
Adcy2 A G 13: 68,727,899 S495P possibly damaging Het
Agbl3 A T 6: 34,799,899 M447L probably damaging Het
Asxl1 C T 2: 153,400,209 T893I probably benign Het
Atp11b T A 3: 35,812,252 I400N probably damaging Het
Bpifb2 C T 2: 153,882,679 probably benign Het
Capn1 T A 19: 6,014,343 Y42F probably benign Het
Cdk5rap2 A T 4: 70,360,901 L190H probably damaging Het
Cfap54 T C 10: 93,035,433 I594V probably null Het
Cpsf1 A G 15: 76,599,553 V830A probably benign Het
Cyp2c70 T A 19: 40,165,371 N258I possibly damaging Het
Dctn1 T G 6: 83,191,134 Y386D probably damaging Het
Degs2 T C 12: 108,692,154 N189D probably damaging Het
Diras1 G T 10: 81,022,138 S93* probably null Het
E130308A19Rik T A 4: 59,690,290 H41Q possibly damaging Het
Ebf2 C T 14: 67,310,968 probably benign Het
Fcho2 A G 13: 98,755,544 probably benign Het
Gbe1 T A 16: 70,561,132 Y681* probably null Het
Gm10036 A C 18: 15,832,816 K8T probably benign Het
Herc1 T A 9: 66,448,175 M2236K probably benign Het
Hmcn2 A T 2: 31,412,508 Y2948F probably damaging Het
Jakmip2 A T 18: 43,582,105 C119S probably benign Het
Kif1b A G 4: 149,263,601 probably benign Het
Kif6 T C 17: 49,832,256 probably benign Het
Lpin1 A T 12: 16,568,529 probably benign Het
Lrp2 T C 2: 69,527,555 I377V probably benign Het
Mavs C A 2: 131,242,024 T147N probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mreg T G 1: 72,162,375 T153P probably damaging Het
Naglu T C 11: 101,071,217 I172T probably damaging Het
Ogdhl T C 14: 32,339,328 V492A possibly damaging Het
Olfr1245 A G 2: 89,575,630 I32T possibly damaging Het
Parvg A G 15: 84,337,882 E323G probably benign Het
Pgap1 A G 1: 54,493,368 L664S probably damaging Het
Pgm2l1 A G 7: 100,250,332 N51S probably benign Het
Pik3r6 A G 11: 68,544,750 T609A probably benign Het
Plcb4 T A 2: 135,971,856 V705E probably damaging Het
Plppr5 T A 3: 117,671,889 probably null Het
Prkg2 C A 5: 98,973,130 D411Y probably damaging Het
Ptprd A G 4: 76,086,329 V63A probably benign Het
Ptprz1 T A 6: 23,007,403 I1655N probably damaging Het
Raf1 T A 6: 115,623,515 D10V probably benign Het
Rexo1 T A 10: 80,544,378 Q928L probably benign Het
Rpl7l1 A C 17: 46,778,530 probably null Het
Rrm2b A G 15: 37,953,688 S39P possibly damaging Het
Scn5a A G 9: 119,492,047 probably null Het
Sgtb A G 13: 104,129,260 T93A probably benign Het
Sigirr G T 7: 141,092,313 probably null Het
Slc16a7 T C 10: 125,228,082 D462G probably benign Het
Slc25a30 C T 14: 75,769,649 A85T probably benign Het
Spata24 A G 18: 35,656,834 S167P probably damaging Het
Spock3 C T 8: 63,144,007 T115I possibly damaging Het
Srgap2 A G 1: 131,319,551 I581T possibly damaging Het
Syn2 A T 6: 115,135,147 M23L unknown Het
Synrg G A 11: 84,009,181 V839I probably damaging Het
Tmtc1 A G 6: 148,412,829 probably benign Het
Tnfaip3 C A 10: 19,011,626 M50I probably damaging Het
Topbp1 T A 9: 103,325,773 I721N possibly damaging Het
Ttc22 T G 4: 106,636,806 V321G probably benign Het
Ttc25 A T 11: 100,567,001 I477F probably damaging Het
Ubr2 A G 17: 46,992,985 probably benign Het
Ubr4 T C 4: 139,437,058 probably benign Het
Usp24 T C 4: 106,412,084 probably benign Het
Vmn2r100 A T 17: 19,522,179 I272L possibly damaging Het
Vrtn T A 12: 84,648,605 L43H probably damaging Het
Wnk1 G T 6: 120,037,149 R162S probably damaging Het
Xkr9 G A 1: 13,684,062 W93* probably null Het
Zfp804b G T 5: 6,769,655 P1136H probably damaging Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180675112 missense probably benign
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7946:Dido1 UTSW 2 180661708 missense possibly damaging 0.81
R7951:Dido1 UTSW 2 180670881 missense probably benign 0.01
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
R8331:Dido1 UTSW 2 180660449 missense probably benign 0.00
R8479:Dido1 UTSW 2 180673229 critical splice donor site probably null
R8936:Dido1 UTSW 2 180661402 missense probably benign
R9089:Dido1 UTSW 2 180661500 missense probably benign 0.00
R9647:Dido1 UTSW 2 180673275 missense probably benign 0.00
R9648:Dido1 UTSW 2 180660675 missense probably damaging 1.00
R9784:Dido1 UTSW 2 180683561 missense probably benign 0.27
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGTGACATCAATGCATCGGACACAG -3'
(R):5'- CACATCAGGATTCCAAGGCCAAGG -3'

Sequencing Primer
(F):5'- TCGGAGAGCTTCTTCTTGC -3'
(R):5'- GTTCTCAAAAGACAAGGCTCTG -3'
Posted On 2013-05-09