Incidental Mutation 'R4431:Vps13b'
ID 328628
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 041146-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4431 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 35371160-35931229 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 35770753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 2114 (Q2114P)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: Q2114P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: Q2114P

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Meta Mutation Damage Score 0.3611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 (GRCm38) probably benign Het
2510039O18Rik T C 4: 147,941,565 (GRCm38) S181P probably benign Het
4930522L14Rik A T 5: 109,736,574 (GRCm38) C473S possibly damaging Het
4930523C07Rik A T 1: 160,044,579 (GRCm38) noncoding transcript Het
9230110C19Rik A G 9: 8,027,177 (GRCm38) V120A probably damaging Het
Aak1 A G 6: 86,986,318 (GRCm38) K910R unknown Het
Abca2 A G 2: 25,442,852 (GRCm38) D1521G probably benign Het
Adamts20 C A 15: 94,344,043 (GRCm38) D695Y probably damaging Het
Bag4 C T 8: 25,769,488 (GRCm38) A228T probably benign Het
Bspry T A 4: 62,482,667 (GRCm38) I132N possibly damaging Het
Cfh T C 1: 140,136,266 (GRCm38) Y424C probably damaging Het
Chd2 T C 7: 73,435,961 (GRCm38) R1642G possibly damaging Het
Chrm2 A G 6: 36,524,162 (GRCm38) D318G probably benign Het
Chrna4 A G 2: 181,028,620 (GRCm38) S448P probably damaging Het
Cldn8 A C 16: 88,562,731 (GRCm38) M102R probably damaging Het
Dock8 T C 19: 25,065,390 (GRCm38) V112A probably benign Het
Fbxo42 C A 4: 141,200,550 (GRCm38) R714S probably damaging Het
Fmo1 G A 1: 162,833,712 (GRCm38) A334V possibly damaging Het
Gpr68 A T 12: 100,899,391 (GRCm38) probably benign Het
Gramd4 A G 15: 86,130,160 (GRCm38) K345R probably damaging Het
Gtpbp1 T G 15: 79,716,197 (GRCm38) S444A probably damaging Het
Ints12 T C 3: 133,102,481 (GRCm38) Y207H probably damaging Het
Kat2b-ps A T 5: 93,392,584 (GRCm38) noncoding transcript Het
Klhl25 T A 7: 75,865,414 (GRCm38) F23I probably damaging Het
Lamc1 A G 1: 153,221,528 (GRCm38) I1590T probably damaging Het
Lhfpl4 A G 6: 113,193,844 (GRCm38) I127T possibly damaging Het
Lrrc71 A G 3: 87,742,836 (GRCm38) S286P possibly damaging Het
Man1c1 A T 4: 134,703,018 (GRCm38) V151D probably damaging Het
Mipol1 G A 12: 57,303,524 (GRCm38) R36Q possibly damaging Het
Nuggc T A 14: 65,611,210 (GRCm38) W187R probably benign Het
Olfr1243 A G 2: 89,527,643 (GRCm38) Y256H probably damaging Het
Pkhd1 G A 1: 20,523,314 (GRCm38) T1525I probably damaging Het
Pomp A G 5: 147,875,479 (GRCm38) E125G probably damaging Het
Ptar1 G T 19: 23,694,331 (GRCm38) G33C probably damaging Het
Ptpn3 A G 4: 57,235,355 (GRCm38) S335P probably damaging Het
Pus7 A G 5: 23,746,489 (GRCm38) Y521H probably benign Het
Shank1 C T 7: 44,319,652 (GRCm38) R324* probably null Het
Slc12a3 A T 8: 94,343,085 (GRCm38) I541F probably damaging Het
Slc12a9 G A 5: 137,321,513 (GRCm38) P580L probably benign Het
Spz1 A G 13: 92,575,329 (GRCm38) L213P probably damaging Het
Strn A G 17: 78,736,462 (GRCm38) V9A probably damaging Het
Sytl5 A T X: 9,960,023 (GRCm38) N412Y probably damaging Het
Tert T A 13: 73,627,475 (GRCm38) F115Y probably damaging Het
Tmem67 T A 4: 12,051,473 (GRCm38) N785I possibly damaging Het
Trf T C 9: 103,211,876 (GRCm38) N243S possibly damaging Het
Ttc3 T C 16: 94,410,958 (GRCm38) probably null Het
Uhrf1bp1 A G 17: 27,885,931 (GRCm38) N533S probably damaging Het
Vmn2r22 T C 6: 123,637,858 (GRCm38) T258A possibly damaging Het
Wdfy1 T A 1: 79,713,866 (GRCm38) R275* probably null Het
Wnt2b A G 3: 104,952,940 (GRCm38) L217S probably damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,226 (GRCm38) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,793,884 (GRCm38) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,557 (GRCm38) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,577 (GRCm38) missense probably benign
IGL00753:Vps13b APN 15 35,372,031 (GRCm38) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,846,900 (GRCm38) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,770 (GRCm38) splice site probably benign
IGL01349:Vps13b APN 15 35,793,945 (GRCm38) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,479 (GRCm38) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,454,957 (GRCm38) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,489 (GRCm38) splice site probably benign
IGL01642:Vps13b APN 15 35,792,072 (GRCm38) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,333 (GRCm38) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,789 (GRCm38) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,799 (GRCm38) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,847 (GRCm38) splice site probably benign
IGL01982:Vps13b APN 15 35,438,904 (GRCm38) nonsense probably null
IGL01997:Vps13b APN 15 35,709,224 (GRCm38) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,245 (GRCm38) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,586 (GRCm38) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,613 (GRCm38) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,081 (GRCm38) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,333 (GRCm38) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,056 (GRCm38) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,514 (GRCm38) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,741 (GRCm38) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,162 (GRCm38) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,096 (GRCm38) missense probably benign
IGL02553:Vps13b APN 15 35,646,301 (GRCm38) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,639,958 (GRCm38) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,142 (GRCm38) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,128 (GRCm38) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,879,900 (GRCm38) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,519 (GRCm38) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,820 (GRCm38) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,300 (GRCm38) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,170 (GRCm38) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,639,866 (GRCm38) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,340 (GRCm38) missense probably benign
omlette UTSW 15 35,671,400 (GRCm38) missense probably benign 0.13
swiss UTSW 15 35,709,673 (GRCm38) missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35,846,957 (GRCm38) missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35,846,957 (GRCm38) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,846,957 (GRCm38) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,846,957 (GRCm38) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,846,957 (GRCm38) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,825 (GRCm38) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,263 (GRCm38) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,240 (GRCm38) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,301 (GRCm38) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,301 (GRCm38) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,119 (GRCm38) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,119 (GRCm38) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,119 (GRCm38) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,155 (GRCm38) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,261 (GRCm38) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,528 (GRCm38) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,261 (GRCm38) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,219 (GRCm38) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,471,899 (GRCm38) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,261 (GRCm38) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,828 (GRCm38) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,803 (GRCm38) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,133 (GRCm38) nonsense probably null
R0463:Vps13b UTSW 15 35,597,409 (GRCm38) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,602 (GRCm38) nonsense probably null
R0472:Vps13b UTSW 15 35,417,633 (GRCm38) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,050 (GRCm38) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,368 (GRCm38) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,657 (GRCm38) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,371,999 (GRCm38) nonsense probably null
R0679:Vps13b UTSW 15 35,709,703 (GRCm38) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,361 (GRCm38) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,363 (GRCm38) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,454 (GRCm38) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,312 (GRCm38) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,122 (GRCm38) splice site probably benign
R1453:Vps13b UTSW 15 35,422,444 (GRCm38) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,484 (GRCm38) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,484 (GRCm38) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,573 (GRCm38) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,839,975 (GRCm38) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,730 (GRCm38) nonsense probably null
R1536:Vps13b UTSW 15 35,875,566 (GRCm38) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,181 (GRCm38) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,319 (GRCm38) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,436 (GRCm38) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,272 (GRCm38) nonsense probably null
R1695:Vps13b UTSW 15 35,576,521 (GRCm38) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,619 (GRCm38) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,791 (GRCm38) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,791 (GRCm38) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,205 (GRCm38) nonsense probably null
R1804:Vps13b UTSW 15 35,917,137 (GRCm38) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,059 (GRCm38) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,642 (GRCm38) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,577 (GRCm38) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,232 (GRCm38) missense probably damaging 0.99
R1850:Vps13b UTSW 15 35,674,959 (GRCm38) splice site probably benign
R1884:Vps13b UTSW 15 35,430,291 (GRCm38) splice site probably benign
R1938:Vps13b UTSW 15 35,709,507 (GRCm38) missense probably damaging 1.00
R1955:Vps13b UTSW 15 35,925,408 (GRCm38) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,407 (GRCm38) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,689 (GRCm38) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,142 (GRCm38) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,142 (GRCm38) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,142 (GRCm38) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,741 (GRCm38) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,447 (GRCm38) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,746 (GRCm38) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,493 (GRCm38) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,080 (GRCm38) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,400 (GRCm38) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,188 (GRCm38) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,189 (GRCm38) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,197 (GRCm38) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,597 (GRCm38) missense probably benign
R2263:Vps13b UTSW 15 35,646,181 (GRCm38) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,105 (GRCm38) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,674,899 (GRCm38) nonsense probably null
R2351:Vps13b UTSW 15 35,869,311 (GRCm38) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,555 (GRCm38) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,361 (GRCm38) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,361 (GRCm38) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,395 (GRCm38) missense probably damaging 1.00
R3236:Vps13b UTSW 15 35,910,304 (GRCm38) missense probably benign 0.40
R3404:Vps13b UTSW 15 35,926,054 (GRCm38) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,382 (GRCm38) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,128 (GRCm38) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,027 (GRCm38) splice site probably null
R4224:Vps13b UTSW 15 35,876,419 (GRCm38) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,294 (GRCm38) missense probably damaging 0.98
R4449:Vps13b UTSW 15 35,876,793 (GRCm38) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,673 (GRCm38) missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35,646,132 (GRCm38) missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35,770,689 (GRCm38) missense probably benign
R4666:Vps13b UTSW 15 35,640,544 (GRCm38) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,821 (GRCm38) missense probably benign
R4684:Vps13b UTSW 15 35,841,341 (GRCm38) missense probably benign
R4684:Vps13b UTSW 15 35,646,178 (GRCm38) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,718 (GRCm38) nonsense probably null
R4771:Vps13b UTSW 15 35,910,800 (GRCm38) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,224 (GRCm38) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,372 (GRCm38) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,293 (GRCm38) missense probably benign
R4857:Vps13b UTSW 15 35,456,654 (GRCm38) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,515 (GRCm38) splice site probably null
R5095:Vps13b UTSW 15 35,923,202 (GRCm38) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,809 (GRCm38) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,678 (GRCm38) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,453 (GRCm38) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,421 (GRCm38) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,421 (GRCm38) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,413 (GRCm38) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,528 (GRCm38) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,886,948 (GRCm38) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,385 (GRCm38) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,542 (GRCm38) missense probably benign
R5489:Vps13b UTSW 15 35,770,542 (GRCm38) missense probably benign
R5503:Vps13b UTSW 15 35,452,166 (GRCm38) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,929,919 (GRCm38) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,035 (GRCm38) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,351 (GRCm38) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,061 (GRCm38) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,772 (GRCm38) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,471,968 (GRCm38) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,471,968 (GRCm38) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,316 (GRCm38) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,738 (GRCm38) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,031 (GRCm38) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,464 (GRCm38) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,126 (GRCm38) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,847 (GRCm38) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,101 (GRCm38) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,696 (GRCm38) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,305 (GRCm38) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,249 (GRCm38) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,683 (GRCm38) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,611 (GRCm38) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,590 (GRCm38) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,309 (GRCm38) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,395 (GRCm38) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,198 (GRCm38) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,689 (GRCm38) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,581 (GRCm38) missense probably benign 0.02
R7092:Vps13b UTSW 15 35,640,634 (GRCm38) missense probably damaging 1.00
R7232:Vps13b UTSW 15 35,877,557 (GRCm38) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,545 (GRCm38) missense probably benign
R7400:Vps13b UTSW 15 35,378,900 (GRCm38) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,827 (GRCm38) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,697 (GRCm38) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,524 (GRCm38) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,439 (GRCm38) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,646 (GRCm38) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,232 (GRCm38) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,879,913 (GRCm38) missense probably benign
R8094:Vps13b UTSW 15 35,668,906 (GRCm38) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,346 (GRCm38) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,109 (GRCm38) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,272 (GRCm38) nonsense probably null
R8174:Vps13b UTSW 15 35,709,310 (GRCm38) nonsense probably null
R8225:Vps13b UTSW 15 35,794,382 (GRCm38) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,404 (GRCm38) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,203 (GRCm38) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,639,917 (GRCm38) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,886,954 (GRCm38) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,100 (GRCm38) missense probably benign
R8494:Vps13b UTSW 15 35,422,448 (GRCm38) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,320 (GRCm38) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,745 (GRCm38) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,642 (GRCm38) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,389 (GRCm38) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,337 (GRCm38) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,066 (GRCm38) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,299 (GRCm38) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,324 (GRCm38) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,785 (GRCm38) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,391 (GRCm38) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,773 (GRCm38) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,647 (GRCm38) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,746 (GRCm38) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,333 (GRCm38) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,779 (GRCm38) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,773 (GRCm38) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,144 (GRCm38) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,846,913 (GRCm38) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,054 (GRCm38) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,419 (GRCm38) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,734 (GRCm38) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,311 (GRCm38) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,409 (GRCm38) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,409 (GRCm38) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,628 (GRCm38) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,234 (GRCm38) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,674,887 (GRCm38) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,257 (GRCm38) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,674,876 (GRCm38) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,406 (GRCm38) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,646 (GRCm38) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,431 (GRCm38) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,668,885 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCCCGTCAGACTCTATACTG -3'
(R):5'- TAGAACTGTTCCCATCTCTAATGAC -3'

Sequencing Primer
(F):5'- ACTGAATATGGATGAGCCTCCTGTC -3'
(R):5'- GCATTTTTCACATGCTAACAAAGGG -3'
Posted On 2015-07-21