Incidental Mutation 'R4431:Gtpbp1'
ID328629
Institutional Source Beutler Lab
Gene Symbol Gtpbp1
Ensembl Gene ENSMUSG00000042535
Gene NameGTP binding protein 1
SynonymsGP-1, GTPBP1
MMRRC Submission 041146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4431 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79690845-79721479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79716197 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 444 (S444A)
Ref Sequence ENSEMBL: ENSMUSP00000043575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046463] [ENSMUST00000230262] [ENSMUST00000231095]
PDB Structure
Murine Alloreactive ScFv TCR-Peptide-MHC Class I Molecule Complex [X-RAY DIFFRACTION]
Mhc Class I H-2Kb molecule complexed with pKB1 peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000046463
AA Change: S444A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043575
Gene: ENSMUSG00000042535
AA Change: S444A

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
Pfam:GTP_EFTU 160 385 2.7e-24 PFAM
low complexity region 402 420 N/A INTRINSIC
SCOP:d1exma2 491 575 4e-19 SMART
low complexity region 605 619 N/A INTRINSIC
low complexity region 645 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228991
Predicted Effect probably benign
Transcript: ENSMUST00000229583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230023
Predicted Effect probably benign
Transcript: ENSMUST00000230262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230496
Predicted Effect probably benign
Transcript: ENSMUST00000231095
Meta Mutation Damage Score 0.5264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated by interferon-gamma and encodes a protein that is a member of the AGP11/GTPBP1 family of GTP-binding proteins. A structurally similar protein has been found in mouse, where disruption of the gene for that protein had no observable phenotype. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted null mutation were viable and fertile with no obvious morphological or behavioral defects. In addition, no defects in macrophage function were observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
2510039O18Rik T C 4: 147,941,565 S181P probably benign Het
4930522L14Rik A T 5: 109,736,574 C473S possibly damaging Het
4930523C07Rik A T 1: 160,044,579 noncoding transcript Het
9230110C19Rik A G 9: 8,027,177 V120A probably damaging Het
Aak1 A G 6: 86,986,318 K910R unknown Het
Abca2 A G 2: 25,442,852 D1521G probably benign Het
Adamts20 C A 15: 94,344,043 D695Y probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bspry T A 4: 62,482,667 I132N possibly damaging Het
Cfh T C 1: 140,136,266 Y424C probably damaging Het
Chd2 T C 7: 73,435,961 R1642G possibly damaging Het
Chrm2 A G 6: 36,524,162 D318G probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fbxo42 C A 4: 141,200,550 R714S probably damaging Het
Fmo1 G A 1: 162,833,712 A334V possibly damaging Het
Gpr68 A T 12: 100,899,391 probably benign Het
Gramd4 A G 15: 86,130,160 K345R probably damaging Het
Ints12 T C 3: 133,102,481 Y207H probably damaging Het
Kat2b-ps A T 5: 93,392,584 noncoding transcript Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Lamc1 A G 1: 153,221,528 I1590T probably damaging Het
Lhfpl4 A G 6: 113,193,844 I127T possibly damaging Het
Lrrc71 A G 3: 87,742,836 S286P possibly damaging Het
Man1c1 A T 4: 134,703,018 V151D probably damaging Het
Mipol1 G A 12: 57,303,524 R36Q possibly damaging Het
Nuggc T A 14: 65,611,210 W187R probably benign Het
Olfr1243 A G 2: 89,527,643 Y256H probably damaging Het
Pkhd1 G A 1: 20,523,314 T1525I probably damaging Het
Pomp A G 5: 147,875,479 E125G probably damaging Het
Ptar1 G T 19: 23,694,331 G33C probably damaging Het
Ptpn3 A G 4: 57,235,355 S335P probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Shank1 C T 7: 44,319,652 R324* probably null Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slc12a9 G A 5: 137,321,513 P580L probably benign Het
Spz1 A G 13: 92,575,329 L213P probably damaging Het
Strn A G 17: 78,736,462 V9A probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trf T C 9: 103,211,876 N243S possibly damaging Het
Ttc3 T C 16: 94,410,958 probably null Het
Uhrf1bp1 A G 17: 27,885,931 N533S probably damaging Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vps13b A C 15: 35,770,753 Q2114P probably damaging Het
Wdfy1 T A 1: 79,713,866 R275* probably null Het
Wnt2b A G 3: 104,952,940 L217S probably damaging Het
Other mutations in Gtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Gtpbp1 APN 15 79719136 missense possibly damaging 0.90
IGL01783:Gtpbp1 APN 15 79716197 missense probably damaging 1.00
IGL01794:Gtpbp1 APN 15 79716246 missense probably damaging 1.00
IGL01859:Gtpbp1 APN 15 79719140 missense probably benign
IGL02245:Gtpbp1 APN 15 79690926 missense probably benign 0.02
IGL02532:Gtpbp1 APN 15 79720077 missense probably benign 0.05
IGL02730:Gtpbp1 APN 15 79719171 missense probably benign
IGL02796:Gtpbp1 UTSW 15 79716985 missense possibly damaging 0.83
R0525:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0531:Gtpbp1 UTSW 15 79720091 missense probably damaging 1.00
R0535:Gtpbp1 UTSW 15 79707732 missense probably damaging 1.00
R0665:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0760:Gtpbp1 UTSW 15 79719155 missense probably damaging 0.99
R0799:Gtpbp1 UTSW 15 79716200 missense probably damaging 1.00
R1445:Gtpbp1 UTSW 15 79713448 missense possibly damaging 0.82
R1458:Gtpbp1 UTSW 15 79707729 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1498:Gtpbp1 UTSW 15 79719021 splice site probably null
R1567:Gtpbp1 UTSW 15 79712190 missense probably damaging 0.98
R3028:Gtpbp1 UTSW 15 79715879 missense possibly damaging 0.64
R4583:Gtpbp1 UTSW 15 79715951 missense possibly damaging 0.64
R4854:Gtpbp1 UTSW 15 79719205 missense probably benign
R4925:Gtpbp1 UTSW 15 79715968 missense probably benign 0.23
R5023:Gtpbp1 UTSW 15 79719221 missense possibly damaging 0.49
R5052:Gtpbp1 UTSW 15 79715969 missense probably damaging 1.00
R5695:Gtpbp1 UTSW 15 79712174 unclassified probably null
R6009:Gtpbp1 UTSW 15 79712096 missense probably damaging 1.00
R6089:Gtpbp1 UTSW 15 79706997 missense probably benign 0.15
R7088:Gtpbp1 UTSW 15 79719282 missense
R7343:Gtpbp1 UTSW 15 79691042 missense probably benign 0.03
R7383:Gtpbp1 UTSW 15 79716153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTACTCTGTCCCTGTAAGTG -3'
(R):5'- CTAAGTGCTCAGGCCATAGC -3'

Sequencing Primer
(F):5'- GTCCCTGTAAGTGCCTCTGG -3'
(R):5'- TCCTCTGTGAAAACAGGGTC -3'
Posted On2015-07-21