Incidental Mutation 'R4432:Dnm3'
ID328639
Institutional Source Beutler Lab
Gene Symbol Dnm3
Ensembl Gene ENSMUSG00000040265
Gene Namedynamin 3
SynonymsB230343F03Rik, 9630020E24Rik
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161982453-162478034 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 161991997 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070330] [ENSMUST00000086074] [ENSMUST00000159763]
Predicted Effect probably benign
Transcript: ENSMUST00000070330
SMART Domains Protein: ENSMUSP00000064538
Gene: ENSMUSG00000040265

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 644 735 6.82e-33 SMART
low complexity region 738 751 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 799 812 N/A INTRINSIC
low complexity region 824 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086074
SMART Domains Protein: ENSMUSP00000083241
Gene: ENSMUSG00000040265

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 648 739 6.82e-33 SMART
low complexity region 742 755 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 828 856 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159763
SMART Domains Protein: ENSMUSP00000125356
Gene: ENSMUSG00000040265

DomainStartEndE-ValueType
PH 1 94 5.13e-2 SMART
GED 115 206 6.82e-33 SMART
low complexity region 209 222 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193110
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of guanosine triphosphate (GTP)-binding proteins that associate with microtubules and are involved in vesicular transport. The encoded protein functions in the development of megakaryocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Dnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Dnm3 APN 1 162011926 missense probably damaging 1.00
IGL02444:Dnm3 APN 1 162010875 missense possibly damaging 0.46
IGL02481:Dnm3 APN 1 162010902 missense probably damaging 0.99
IGL02623:Dnm3 APN 1 162355432 missense probably damaging 0.99
IGL03132:Dnm3 APN 1 162011105 critical splice acceptor site probably null
IGL03330:Dnm3 APN 1 162320991 missense probably benign 0.00
fever UTSW 1 162321127 splice site probably null
nobel UTSW 1 162477705 missense probably damaging 1.00
splotare UTSW 1 162320987 missense probably damaging 0.98
LCD18:Dnm3 UTSW 1 162406561 intron probably benign
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0968:Dnm3 UTSW 1 162019819 splice site probably benign
R1161:Dnm3 UTSW 1 162353574 missense probably benign 0.06
R1680:Dnm3 UTSW 1 162010976 missense probably benign 0.12
R1747:Dnm3 UTSW 1 162313584 missense probably damaging 1.00
R1881:Dnm3 UTSW 1 162477948 start gained probably benign
R1997:Dnm3 UTSW 1 162353712 missense possibly damaging 0.60
R2157:Dnm3 UTSW 1 162307893 missense possibly damaging 0.95
R2270:Dnm3 UTSW 1 162477789 missense probably damaging 1.00
R2897:Dnm3 UTSW 1 162286074 splice site probably benign
R3018:Dnm3 UTSW 1 162321759 nonsense probably null
R3851:Dnm3 UTSW 1 162321127 splice site probably null
R3861:Dnm3 UTSW 1 162311405 missense possibly damaging 0.79
R3930:Dnm3 UTSW 1 162084130 missense probably damaging 1.00
R5318:Dnm3 UTSW 1 162011807 nonsense probably null
R5361:Dnm3 UTSW 1 162010902 missense probably damaging 0.99
R5606:Dnm3 UTSW 1 162286018 missense probably damaging 0.99
R5783:Dnm3 UTSW 1 162355471 missense possibly damaging 0.70
R6019:Dnm3 UTSW 1 162134501 missense probably damaging 0.99
R6072:Dnm3 UTSW 1 162011068 small deletion probably benign
R6086:Dnm3 UTSW 1 162321033 missense probably damaging 0.99
R6110:Dnm3 UTSW 1 162011068 small deletion probably benign
R6158:Dnm3 UTSW 1 162320987 missense probably damaging 0.98
R6473:Dnm3 UTSW 1 162477705 missense probably damaging 1.00
R6499:Dnm3 UTSW 1 162313595 missense probably damaging 1.00
R6702:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6703:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6739:Dnm3 UTSW 1 162477783 missense probably damaging 0.99
R6811:Dnm3 UTSW 1 162321083 missense probably damaging 0.96
R6915:Dnm3 UTSW 1 162318397 splice site probably null
R6946:Dnm3 UTSW 1 162313655 missense possibly damaging 0.91
R7062:Dnm3 UTSW 1 162134491 nonsense probably null
R7067:Dnm3 UTSW 1 162320971 missense probably damaging 1.00
R7071:Dnm3 UTSW 1 162019843 missense probably damaging 0.99
R7468:Dnm3 UTSW 1 162321629 splice site probably null
R7521:Dnm3 UTSW 1 162134544 missense probably damaging 1.00
R7583:Dnm3 UTSW 1 162477774 missense possibly damaging 0.93
R7667:Dnm3 UTSW 1 162011830 missense probably damaging 1.00
R7711:Dnm3 UTSW 1 161992053 missense possibly damaging 0.83
R7837:Dnm3 UTSW 1 161992050 missense possibly damaging 0.94
R7838:Dnm3 UTSW 1 161992050 missense possibly damaging 0.94
R7900:Dnm3 UTSW 1 162355371 missense probably benign 0.00
R7939:Dnm3 UTSW 1 162295596 missense possibly damaging 0.91
R8059:Dnm3 UTSW 1 162084139 missense probably damaging 1.00
R8123:Dnm3 UTSW 1 162011103 missense probably benign 0.01
R8246:Dnm3 UTSW 1 162307917 missense probably damaging 1.00
R8249:Dnm3 UTSW 1 162477743 nonsense probably null
R8511:Dnm3 UTSW 1 162286042 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCTGCTGTATAAAACTACCTTGG -3'
(R):5'- GCATGGTGGCTCTATGTCAG -3'

Sequencing Primer
(F):5'- TAAGCCTCTCTACAGGTTAGCAGG -3'
(R):5'- CAGTGTTCTGAAGAGACAACTACTGC -3'
Posted On2015-07-21