Incidental Mutation 'R4432:Mapkap1'
ID328640
Institutional Source Beutler Lab
Gene Symbol Mapkap1
Ensembl Gene ENSMUSG00000038696
Gene Namemitogen-activated protein kinase associated protein 1
SynonymsSin1, D230039K05Rik
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34406771-34624950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34619863 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 263 (L263P)
Ref Sequence ENSEMBL: ENSMUSP00000123301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113123] [ENSMUST00000113124] [ENSMUST00000113126] [ENSMUST00000124443] [ENSMUST00000147337]
Predicted Effect probably damaging
Transcript: ENSMUST00000113123
AA Change: L263P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108748
Gene: ENSMUSG00000038696
AA Change: L263P

DomainStartEndE-ValueType
Pfam:SIN1 1 289 2e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113124
AA Change: L419P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108749
Gene: ENSMUSG00000038696
AA Change: L419P

DomainStartEndE-ValueType
Pfam:SIN1 18 324 4.7e-125 PFAM
Pfam:SIN1 318 445 2.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113126
AA Change: L455P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108751
Gene: ENSMUSG00000038696
AA Change: L455P

DomainStartEndE-ValueType
Pfam:SIN1 18 481 1.1e-188 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124443
AA Change: L263P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123301
Gene: ENSMUSG00000038696
AA Change: L263P

DomainStartEndE-ValueType
Pfam:SIN1 1 289 1.6e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129633
Predicted Effect probably damaging
Transcript: ENSMUST00000147337
AA Change: L455P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116494
Gene: ENSMUSG00000038696
AA Change: L455P

DomainStartEndE-ValueType
Pfam:SIN1 18 129 1.2e-32 PFAM
Pfam:CRIM 139 276 3.3e-38 PFAM
Pfam:SIN1_PH 381 488 3.4e-34 PFAM
Meta Mutation Damage Score 0.9249 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality due to early developmental abnormalities. Mutant mouse embryonic fibroblasts display increased susceptibility to stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Mapkap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Mapkap1 APN 2 34518843 missense probably damaging 1.00
IGL02104:Mapkap1 APN 2 34623470 nonsense probably null
IGL02390:Mapkap1 APN 2 34432089 missense probably damaging 0.99
IGL02508:Mapkap1 APN 2 34518669 splice site probably benign
IGL02817:Mapkap1 APN 2 34563118 missense probably damaging 1.00
PIT4696001:Mapkap1 UTSW 2 34619849 missense probably damaging 0.96
R0129:Mapkap1 UTSW 2 34623482 missense probably damaging 1.00
R0480:Mapkap1 UTSW 2 34533781 splice site probably benign
R1966:Mapkap1 UTSW 2 34518679 missense probably damaging 0.98
R2167:Mapkap1 UTSW 2 34597482 missense probably damaging 1.00
R4789:Mapkap1 UTSW 2 34533847 missense possibly damaging 0.64
R4805:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4806:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4807:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4808:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4862:Mapkap1 UTSW 2 34623430 missense probably damaging 1.00
R4989:Mapkap1 UTSW 2 34581291 missense probably damaging 1.00
R5283:Mapkap1 UTSW 2 34444348 missense probably damaging 1.00
R6186:Mapkap1 UTSW 2 34563114 missense possibly damaging 0.76
R6248:Mapkap1 UTSW 2 34518680 missense probably damaging 1.00
R6891:Mapkap1 UTSW 2 34563141 missense probably damaging 1.00
R6985:Mapkap1 UTSW 2 34432110 missense probably damaging 1.00
R7078:Mapkap1 UTSW 2 34563139 missense probably damaging 1.00
R7179:Mapkap1 UTSW 2 34518700 missense possibly damaging 0.88
R7336:Mapkap1 UTSW 2 34533817 missense possibly damaging 0.51
R7392:Mapkap1 UTSW 2 34435154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGCACTGTGAGTCTTC -3'
(R):5'- CAGAGAAGAGCTAGGCCTTTG -3'

Sequencing Primer
(F):5'- CACTGCCTGCCTTAGACCAG -3'
(R):5'- AAGCTGACAGTCCTGCTTTG -3'
Posted On2015-07-21