Incidental Mutation 'R4432:Olfr1288'
ID328643
Institutional Source Beutler Lab
Gene Symbol Olfr1288
Ensembl Gene ENSMUSG00000044039
Gene Nameolfactory receptor 1288
SynonymsMOR245-9, GA_x6K02T2Q125-72530279-72531217
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111474101-111479994 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 111479412 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 209 (C209*)
Ref Sequence ENSEMBL: ENSMUSP00000150331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816]
Predicted Effect probably null
Transcript: ENSMUST00000104889
AA Change: C209*
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039
AA Change: C209*

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120021
Predicted Effect probably benign
Transcript: ENSMUST00000207494
Predicted Effect probably null
Transcript: ENSMUST00000214816
AA Change: C209*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Olfr1288
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Olfr1288 APN 2 111478864 missense probably benign
IGL02021:Olfr1288 APN 2 111479480 missense probably benign 0.03
IGL02061:Olfr1288 APN 2 111479269 missense possibly damaging 0.94
R2016:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2017:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2848:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R2849:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R3421:Olfr1288 UTSW 2 111478952 missense probably benign 0.12
R4223:Olfr1288 UTSW 2 111479144 missense probably benign 0.00
R4433:Olfr1288 UTSW 2 111479412 nonsense probably null
R4476:Olfr1288 UTSW 2 111479664 missense possibly damaging 0.58
R4631:Olfr1288 UTSW 2 111479563 missense probably damaging 1.00
R6029:Olfr1288 UTSW 2 111478965 nonsense probably null
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6084:Olfr1288 UTSW 2 111479389 missense probably damaging 1.00
R6329:Olfr1288 UTSW 2 111479228 missense possibly damaging 0.90
R7307:Olfr1288 UTSW 2 111478760 start gained probably benign
R7516:Olfr1288 UTSW 2 111478937 missense probably benign 0.01
R7577:Olfr1288 UTSW 2 111479132 missense probably damaging 0.98
R8108:Olfr1288 UTSW 2 111479234 missense possibly damaging 0.90
R8210:Olfr1288 UTSW 2 111479408 missense possibly damaging 0.89
Z1177:Olfr1288 UTSW 2 111478814 missense probably benign 0.06
Z1177:Olfr1288 UTSW 2 111479207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTACCTGATGATCATGAATCCC -3'
(R):5'- CTTGGTCGGAAATGGCCATAC -3'

Sequencing Primer
(F):5'- TAATAGCAGCTTGGGTCATAGG -3'
(R):5'- TCGGAAATGGCCATACATACAG -3'
Posted On2015-07-21