Incidental Mutation 'R4432:Samhd1'
ID328644
Institutional Source Beutler Lab
Gene Symbol Samhd1
Ensembl Gene ENSMUSG00000027639
Gene NameSAM domain and HD domain, 1
SynonymsE330031J07Rik
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157097533-157135265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157104893 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 558 (D558G)
Ref Sequence ENSEMBL: ENSMUSP00000085880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057725] [ENSMUST00000088523] [ENSMUST00000109549] [ENSMUST00000123932]
Predicted Effect probably damaging
Transcript: ENSMUST00000057725
AA Change: D558G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059717
Gene: ENSMUSG00000027639
AA Change: D558G

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088523
AA Change: D558G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085880
Gene: ENSMUSG00000027639
AA Change: D558G

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 2e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109549
AA Change: D558G

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105176
Gene: ENSMUSG00000027639
AA Change: D558G

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123932
SMART Domains Protein: ENSMUSP00000124599
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SAM 43 112 1.51e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139149
Predicted Effect unknown
Transcript: ENSMUST00000139263
AA Change: D537G
SMART Domains Protein: ENSMUSP00000124935
Gene: ENSMUSG00000027639
AA Change: D537G

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
SAM 54 122 4.4e-14 SMART
HDc 172 337 1.89e-9 SMART
Blast:HDc 378 417 2e-16 BLAST
low complexity region 486 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160213
Meta Mutation Damage Score 0.1984 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in regulation of the innate immune response. The encoded protein is upregulated in response to viral infection and may be involved in mediation of tumor necrosis factor-alpha proinflammatory responses. Mutations in this gene have been associated with Aicardi-Goutieres syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to infection with pseudotyped HIV-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Samhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Samhd1 APN 2 157120548 missense probably damaging 1.00
IGL00903:Samhd1 APN 2 157107423 splice site probably benign
IGL01313:Samhd1 APN 2 157116401 missense probably damaging 1.00
IGL01775:Samhd1 APN 2 157114330 splice site probably benign
IGL02245:Samhd1 APN 2 157110555 missense possibly damaging 0.46
IGL02314:Samhd1 APN 2 157135028 missense probably damaging 0.98
R0390:Samhd1 UTSW 2 157114231 missense probably damaging 1.00
R0487:Samhd1 UTSW 2 157110615 missense probably damaging 1.00
R0842:Samhd1 UTSW 2 157123331 missense probably damaging 0.99
R1199:Samhd1 UTSW 2 157109461 missense probably damaging 0.99
R1681:Samhd1 UTSW 2 157101732 missense probably benign 0.45
R1775:Samhd1 UTSW 2 157107547 missense probably benign 0.16
R2859:Samhd1 UTSW 2 157106229 critical splice donor site probably null
R2903:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R2905:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R3983:Samhd1 UTSW 2 157123449 missense possibly damaging 0.81
R4576:Samhd1 UTSW 2 157101750 missense probably damaging 1.00
R5283:Samhd1 UTSW 2 157109492 missense possibly damaging 0.70
R5741:Samhd1 UTSW 2 157112831 missense probably benign
R6021:Samhd1 UTSW 2 157120554 critical splice acceptor site probably null
R6518:Samhd1 UTSW 2 157114297 missense possibly damaging 0.62
R6818:Samhd1 UTSW 2 157107497 missense probably benign 0.04
R6924:Samhd1 UTSW 2 157109483 missense probably benign 0.00
R7307:Samhd1 UTSW 2 157135020 missense probably benign 0.27
R7337:Samhd1 UTSW 2 157106244 missense probably damaging 0.99
R7596:Samhd1 UTSW 2 157101834 missense probably damaging 1.00
R7892:Samhd1 UTSW 2 157116495 missense probably damaging 1.00
R7975:Samhd1 UTSW 2 157116495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGAAAGCCTGTGTGAG -3'
(R):5'- CAAATCCCCAGAGGTGGTCATG -3'

Sequencing Primer
(F):5'- CCTGCTTAGCTGACTCAGTGG -3'
(R):5'- CAGAGGTGGTCATGTGCCAG -3'
Posted On2015-07-21