Incidental Mutation 'R4432:Slc27a3'
ID328645
Institutional Source Beutler Lab
Gene Symbol Slc27a3
Ensembl Gene ENSMUSG00000027932
Gene Namesolute carrier family 27 (fatty acid transporter), member 3
SynonymsAcsvl3, fatty acid transport protein 3, FATP3
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90385239-90389938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90387340 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 408 (T408M)
Ref Sequence ENSEMBL: ENSMUSP00000029541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029541] [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
Predicted Effect probably damaging
Transcript: ENSMUST00000029541
AA Change: T408M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029541
Gene: ENSMUSG00000027932
AA Change: T408M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
Pfam:AMP-binding 138 535 9.2e-62 PFAM
Pfam:AMP-binding_C 543 619 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029542
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071488
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127064
Predicted Effect unknown
Transcript: ENSMUST00000132041
AA Change: T373M
SMART Domains Protein: ENSMUSP00000122599
Gene: ENSMUSG00000027932
AA Change: T373M

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 68 89 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:AMP-binding 147 501 5.3e-50 PFAM
Pfam:AMP-binding_C 509 585 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153978
Predicted Effect probably benign
Transcript: ENSMUST00000196530
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199992
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of integral membrane proteins and encodes a protein that is involved in lipid metabolism. The increased expression of this gene in human neural stem cells derived from induced pluripotent stem cells suggests that it plays an important role in early brain development. Naturally occurring mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Slc27a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Slc27a3 APN 3 90385441 nonsense probably null
IGL01080:Slc27a3 APN 3 90385460 missense probably benign 0.17
IGL01313:Slc27a3 APN 3 90386554 missense probably damaging 1.00
IGL01358:Slc27a3 APN 3 90386552 missense probably damaging 1.00
IGL02261:Slc27a3 APN 3 90387695 missense probably benign
R0557:Slc27a3 UTSW 3 90386856 missense probably damaging 1.00
R1922:Slc27a3 UTSW 3 90386317 missense probably benign
R2032:Slc27a3 UTSW 3 90387397 missense probably damaging 0.99
R3922:Slc27a3 UTSW 3 90387085 missense possibly damaging 0.65
R4278:Slc27a3 UTSW 3 90389188 unclassified probably benign
R4433:Slc27a3 UTSW 3 90387340 missense probably damaging 0.99
R4672:Slc27a3 UTSW 3 90387646 missense possibly damaging 0.90
R5183:Slc27a3 UTSW 3 90389170 critical splice donor site probably null
R5201:Slc27a3 UTSW 3 90389219 missense probably benign 0.41
R5328:Slc27a3 UTSW 3 90386832 missense probably damaging 1.00
R5405:Slc27a3 UTSW 3 90387075 missense probably benign 0.05
R5477:Slc27a3 UTSW 3 90386839 missense probably benign
R5743:Slc27a3 UTSW 3 90387072 missense probably benign 0.38
R6344:Slc27a3 UTSW 3 90387654 nonsense probably null
R6450:Slc27a3 UTSW 3 90385470 missense probably damaging 0.97
R6988:Slc27a3 UTSW 3 90386290 missense probably benign 0.01
R7204:Slc27a3 UTSW 3 90389726 missense probably benign 0.07
R7736:Slc27a3 UTSW 3 90389433 missense probably benign 0.22
R8045:Slc27a3 UTSW 3 90387142 missense probably damaging 0.99
R8046:Slc27a3 UTSW 3 90389667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCGTATCGAATCAAGGAG -3'
(R):5'- AAGGAACAGGGCTTCACTGG -3'

Sequencing Primer
(F):5'- GAGGGAGAGCCATACTGCGTC -3'
(R):5'- CTTCACTGGGGATCTGGAAGC -3'
Posted On2015-07-21