Incidental Mutation 'R4432:Adamtsl4'
ID328646
Institutional Source Beutler Lab
Gene Symbol Adamtsl4
Ensembl Gene ENSMUSG00000015850
Gene NameADAMTS-like 4
SynonymsTsrc1
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95676201-95687917 bp(-) (GRCm38)
Type of Mutationsplice site (2822 bp from exon)
DNA Base Change (assembly) T to C at 95681759 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015994] [ENSMUST00000117782] [ENSMUST00000148854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015994
AA Change: N454S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015994
Gene: ENSMUSG00000015850
AA Change: N454S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3.9e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 995 1025 4.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117782
AA Change: N454S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113424
Gene: ENSMUSG00000015850
AA Change: N454S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 994 1026 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124410
Predicted Effect probably null
Transcript: ENSMUST00000148854
SMART Domains Protein: ENSMUSP00000120844
Gene: ENSMUSG00000015850

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:TSP1 51 70 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151054
Meta Mutation Damage Score 0.0975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ADAMTS superfamily of secreted proteins, which contain a metalloprotease domain at the N-terminus and a C-terminal ancillary domain. ADAMTS-like proteins lack protease activity and resemble the ancillary domain of ADAMTS proteins. ADAMTS-like proteins have been implicated in regulation of the extracellular matrix. The encoded protein contains 7 thrombospondin type 1 repeats, a conserved extracellular domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Adamtsl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Adamtsl4 APN 3 95677533 missense probably benign 0.22
IGL01685:Adamtsl4 APN 3 95684595 missense possibly damaging 0.93
IGL01707:Adamtsl4 APN 3 95683991 missense probably benign 0.39
IGL02105:Adamtsl4 APN 3 95680064 missense probably damaging 1.00
IGL02545:Adamtsl4 APN 3 95683374 nonsense probably null
IGL03089:Adamtsl4 APN 3 95677246 missense probably damaging 1.00
R0099:Adamtsl4 UTSW 3 95684139 missense probably benign 0.00
R0718:Adamtsl4 UTSW 3 95679608 missense possibly damaging 0.49
R0962:Adamtsl4 UTSW 3 95684488 nonsense probably null
R1157:Adamtsl4 UTSW 3 95683661 missense possibly damaging 0.88
R1434:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R1486:Adamtsl4 UTSW 3 95681856 missense probably benign 0.23
R1579:Adamtsl4 UTSW 3 95685497 start gained probably benign
R1703:Adamtsl4 UTSW 3 95677614 missense probably damaging 1.00
R1757:Adamtsl4 UTSW 3 95677942 missense probably benign 0.00
R2018:Adamtsl4 UTSW 3 95681102 missense probably damaging 1.00
R2108:Adamtsl4 UTSW 3 95681047 missense probably damaging 1.00
R3889:Adamtsl4 UTSW 3 95680857 missense probably damaging 1.00
R4062:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4063:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4124:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4128:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4433:Adamtsl4 UTSW 3 95681759 splice site probably null
R4643:Adamtsl4 UTSW 3 95684619 missense possibly damaging 0.90
R4694:Adamtsl4 UTSW 3 95679745 missense probably damaging 1.00
R4719:Adamtsl4 UTSW 3 95679586 critical splice donor site probably null
R4929:Adamtsl4 UTSW 3 95678005 missense probably damaging 1.00
R5044:Adamtsl4 UTSW 3 95681650 critical splice donor site probably null
R5212:Adamtsl4 UTSW 3 95677670 missense probably damaging 1.00
R5234:Adamtsl4 UTSW 3 95680920 missense probably benign 0.00
R5268:Adamtsl4 UTSW 3 95680163 missense probably damaging 0.98
R5473:Adamtsl4 UTSW 3 95679993 missense probably damaging 0.98
R5509:Adamtsl4 UTSW 3 95681357 missense probably benign 0.00
R5566:Adamtsl4 UTSW 3 95685455 critical splice donor site probably null
R5891:Adamtsl4 UTSW 3 95682313 missense possibly damaging 0.95
R5906:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R6224:Adamtsl4 UTSW 3 95681729 missense probably damaging 1.00
R6530:Adamtsl4 UTSW 3 95681054 missense probably benign 0.00
R6861:Adamtsl4 UTSW 3 95680884 missense probably damaging 1.00
R7199:Adamtsl4 UTSW 3 95680809 missense probably benign 0.00
R8083:Adamtsl4 UTSW 3 95684401 missense possibly damaging 0.76
R8251:Adamtsl4 UTSW 3 95684574 missense probably damaging 1.00
X0028:Adamtsl4 UTSW 3 95676964 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTTTCGTTCGGCTGAAG -3'
(R):5'- AAAGCTCCTCCAGACATAGTGG -3'

Sequencing Primer
(F):5'- CTGAAGAGGGTGTGTAGTAGGC -3'
(R):5'- TACTCTGACTTGAAGCACAAAGAG -3'
Posted On2015-07-21