Incidental Mutation 'R4432:H6pd'
ID328650
Institutional Source Beutler Lab
Gene Symbol H6pd
Ensembl Gene ENSMUSG00000028980
Gene Namehexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
SynonymsGpd-1, Gpd1, G6pd1
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149979475-150009023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 149995758 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 202 (Y202S)
Ref Sequence ENSEMBL: ENSMUSP00000081134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117] [ENSMUST00000153394]
Predicted Effect probably damaging
Transcript: ENSMUST00000030830
AA Change: Y210S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980
AA Change: Y210S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:G6PD_N 34 218 1.6e-41 PFAM
Pfam:G6PD_C 220 523 3.2e-58 PFAM
Pfam:Glucosamine_iso 564 788 8.2e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084117
AA Change: Y202S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980
AA Change: Y202S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 210 8.6e-39 PFAM
Pfam:G6PD_C 212 387 3.6e-42 PFAM
Pfam:Glucosamine_iso 561 758 9.9e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152907
Predicted Effect probably benign
Transcript: ENSMUST00000153394
SMART Domains Protein: ENSMUSP00000115647
Gene: ENSMUSG00000028980

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 172 5e-21 PFAM
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in H6pd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:H6pd APN 4 149994468 critical splice donor site probably null
IGL01450:H6pd APN 4 149984118 missense probably damaging 1.00
IGL01913:H6pd APN 4 149994463 unclassified probably benign
IGL01914:H6pd APN 4 149994463 unclassified probably benign
dryer UTSW 4 149982865 missense probably damaging 1.00
herr UTSW 4 149983902 critical splice donor site probably null
R0402:H6pd UTSW 4 149996316 missense probably damaging 1.00
R0486:H6pd UTSW 4 149982936 splice site probably benign
R0548:H6pd UTSW 4 149981616 missense probably damaging 1.00
R0690:H6pd UTSW 4 149982573 missense possibly damaging 0.93
R1165:H6pd UTSW 4 149995956 missense possibly damaging 0.95
R1298:H6pd UTSW 4 149982514 missense probably benign 0.01
R1331:H6pd UTSW 4 149982415 missense probably benign 0.28
R1581:H6pd UTSW 4 149982514 missense possibly damaging 0.94
R1781:H6pd UTSW 4 149995931 missense probably damaging 1.00
R1791:H6pd UTSW 4 149981673 missense probably damaging 0.97
R1840:H6pd UTSW 4 149982050 missense possibly damaging 0.55
R2290:H6pd UTSW 4 149981881 missense probably damaging 1.00
R3889:H6pd UTSW 4 149995773 missense possibly damaging 0.67
R4576:H6pd UTSW 4 149994476 missense probably damaging 0.99
R4629:H6pd UTSW 4 149996346 missense probably benign 0.10
R4856:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4886:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4951:H6pd UTSW 4 149981587 missense probably damaging 1.00
R5124:H6pd UTSW 4 149982055 missense possibly damaging 0.57
R5337:H6pd UTSW 4 149981784 missense probably benign 0.02
R5408:H6pd UTSW 4 149982865 missense probably damaging 1.00
R5474:H6pd UTSW 4 149996089 missense probably damaging 1.00
R6266:H6pd UTSW 4 149995957 missense probably benign 0.32
R6476:H6pd UTSW 4 149982727 missense probably damaging 0.99
R6725:H6pd UTSW 4 149996358 missense probably damaging 1.00
R6733:H6pd UTSW 4 149985121 intron probably null
R6785:H6pd UTSW 4 149982790 missense possibly damaging 0.50
R6853:H6pd UTSW 4 149982462 missense probably benign 0.00
R6921:H6pd UTSW 4 149982051 missense probably damaging 0.99
R7258:H6pd UTSW 4 149996362 missense probably benign 0.09
R7269:H6pd UTSW 4 149982912 missense probably benign 0.00
R7326:H6pd UTSW 4 149996350 missense probably benign 0.00
R7348:H6pd UTSW 4 149983902 critical splice donor site probably null
R7488:H6pd UTSW 4 149982636 missense probably benign
R7512:H6pd UTSW 4 149995948 missense probably benign 0.00
R7684:H6pd UTSW 4 149996062 missense probably benign
R7704:H6pd UTSW 4 149982903 missense probably benign 0.45
X0020:H6pd UTSW 4 149982798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATAGAGACTGGTCCTGCCTGC -3'
(R):5'- GGATCTTCTACTTCAGTGTGCC -3'

Sequencing Primer
(F):5'- GAGACTGGTCCTGCCTGCTATTC -3'
(R):5'- AGTGTGCCGCCCTTTGC -3'
Posted On2015-07-21