Mutagenetix > Incidental Mutations

Incidental Mutation 'R4432:H6pd'

328650

Institutional Source

Beutler Lab

Gene Symbol

H6pd

Ensembl Gene

ENSMUSG00000028980

Gene Name

hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)

Synonyms

Gpd-1, Gpd1, G6pd1

MMRRC Submission

041701-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R4432 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

149979475-150009023 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 149995758 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 202 (Y202S)

Ref Sequence

ENSEMBL: ENSMUSP00000081134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117] [ENSMUST00000153394]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030830
AA Change: Y210S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980
AA Change: Y210S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:G6PD_N	34	218	1.6e-41	PFAM
Pfam:G6PD_C	220	523	3.2e-58	PFAM
Pfam:Glucosamine_iso	564	788	8.2e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000084117
AA Change: Y202S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980
AA Change: Y202S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:G6PD_N	26	210	8.6e-39	PFAM
Pfam:G6PD_C	212	387	3.6e-42	PFAM
Pfam:Glucosamine_iso	561	758	9.9e-62	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152907

Predicted Effect

probably benign
Transcript: ENSMUST00000153394

SMART Domains

Protein: ENSMUSP00000115647
Gene: ENSMUSG00000028980

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:G6PD_N	26	172	5e-21	PFAM

Meta Mutation Damage Score

0.9749

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	A	T	8: 36,498,478	I51F	probably damaging	Het
Abca6	T	C	11: 110,241,588	M294V	probably benign	Het
Abcc5	A	T	16: 20,368,187		probably null	Het
Acsm4	A	C	7: 119,711,387	E499A	probably damaging	Het
Adamtsl4	T	C	3: 95,681,759		probably null	Het
Ank2	A	T	3: 126,947,806		probably benign	Het
Anks6	G	A	4: 47,044,905	Q334*	probably null	Het
Cadps2	T	A	6: 23,626,738	I155L	probably damaging	Het
Casp4	G	A	9: 5,323,653	R74H	probably damaging	Het
Cdk14	A	G	5: 5,036,427	W298R	probably damaging	Het
Chia1	A	G	3: 106,115,325	N12D	probably benign	Het
Cyp3a59	A	G	5: 146,104,786	D380G	probably benign	Het
Dnm2	T	C	9: 21,491,304		probably benign	Het
Dnm3	T	C	1: 161,991,997		probably benign	Het
Dpp4	A	G	2: 62,345,112	Y660H	probably damaging	Het
Fam92b	C	A	8: 120,174,855	R37L	probably damaging	Het
Hnrnpa0	T	C	13: 58,127,937	K126R	probably benign	Het
Insc	C	T	7: 114,769,055		probably benign	Het
Lrrc45	G	A	11: 120,715,221		probably null	Het
Mapkap1	T	C	2: 34,619,863	L263P	probably damaging	Het
Nmur1	A	G	1: 86,387,565	S160P	probably damaging	Het
Olfr1254	A	T	2: 89,788,734	M206K	possibly damaging	Het
Olfr1288	T	A	2: 111,479,412	C209*	probably null	Het
Pcdhb15	A	G	18: 37,475,512	N599S	probably damaging	Het
Pcid2	T	C	8: 13,085,421	D196G	probably damaging	Het
Pcolce2	T	C	9: 95,681,557	F199L	probably damaging	Het
Phf11c	A	T	14: 59,390,935	N88K	possibly damaging	Het
Prl8a8	T	A	13: 27,510,480	Y109F	probably benign	Het
Rasa2	A	G	9: 96,542,407		probably benign	Het
Samhd1	T	C	2: 157,104,893	D558G	probably damaging	Het
Slc1a1	T	C	19: 28,902,709	F263S	probably benign	Het
Slc27a3	G	A	3: 90,387,340	T408M	probably damaging	Het
Slc4a7	T	A	14: 14,757,323	N520K	probably damaging	Het
Szt2	A	G	4: 118,384,231	S1679P	probably damaging	Het
Vmn1r218	T	C	13: 23,137,242	F173S	possibly damaging	Het
Vmn2r32	T	A	7: 7,479,919	N19Y	probably damaging	Het

Other mutations in H6pd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:H6pd	APN	4	149994468	critical splice donor site	probably null
IGL01450:H6pd	APN	4	149984118	missense	probably damaging	1.00
IGL01913:H6pd	APN	4	149994463	unclassified	probably benign
IGL01914:H6pd	APN	4	149994463	unclassified	probably benign
dryer	UTSW	4	149982865	missense	probably damaging	1.00
herr	UTSW	4	149983902	critical splice donor site	probably null
R0402:H6pd	UTSW	4	149996316	missense	probably damaging	1.00
R0486:H6pd	UTSW	4	149982936	splice site	probably benign
R0548:H6pd	UTSW	4	149981616	missense	probably damaging	1.00
R0690:H6pd	UTSW	4	149982573	missense	possibly damaging	0.93
R1165:H6pd	UTSW	4	149995956	missense	possibly damaging	0.95
R1298:H6pd	UTSW	4	149982514	missense	probably benign	0.01
R1331:H6pd	UTSW	4	149982415	missense	probably benign	0.28
R1581:H6pd	UTSW	4	149982514	missense	possibly damaging	0.94
R1781:H6pd	UTSW	4	149995931	missense	probably damaging	1.00
R1791:H6pd	UTSW	4	149981673	missense	probably damaging	0.97
R1840:H6pd	UTSW	4	149982050	missense	possibly damaging	0.55
R2290:H6pd	UTSW	4	149981881	missense	probably damaging	1.00
R3889:H6pd	UTSW	4	149995773	missense	possibly damaging	0.67
R4576:H6pd	UTSW	4	149994476	missense	probably damaging	0.99
R4629:H6pd	UTSW	4	149996346	missense	probably benign	0.10
R4856:H6pd	UTSW	4	149982778	missense	possibly damaging	0.47
R4886:H6pd	UTSW	4	149982778	missense	possibly damaging	0.47
R4951:H6pd	UTSW	4	149981587	missense	probably damaging	1.00
R5124:H6pd	UTSW	4	149982055	missense	possibly damaging	0.57
R5337:H6pd	UTSW	4	149981784	missense	probably benign	0.02
R5408:H6pd	UTSW	4	149982865	missense	probably damaging	1.00
R5474:H6pd	UTSW	4	149996089	missense	probably damaging	1.00
R6266:H6pd	UTSW	4	149995957	missense	probably benign	0.32
R6476:H6pd	UTSW	4	149982727	missense	probably damaging	0.99
R6725:H6pd	UTSW	4	149996358	missense	probably damaging	1.00
R6733:H6pd	UTSW	4	149985121	intron	probably null
R6785:H6pd	UTSW	4	149982790	missense	possibly damaging	0.50
R6853:H6pd	UTSW	4	149982462	missense	probably benign	0.00
R6921:H6pd	UTSW	4	149982051	missense	probably damaging	0.99
R7258:H6pd	UTSW	4	149996362	missense	probably benign	0.09
R7269:H6pd	UTSW	4	149982912	missense	probably benign	0.00
R7326:H6pd	UTSW	4	149996350	missense	probably benign	0.00
R7348:H6pd	UTSW	4	149983902	critical splice donor site	probably null
R7488:H6pd	UTSW	4	149982636	missense	probably benign
R7512:H6pd	UTSW	4	149995948	missense	probably benign	0.00
R7684:H6pd	UTSW	4	149996062	missense	probably benign
R7704:H6pd	UTSW	4	149982903	missense	probably benign	0.45
X0020:H6pd	UTSW	4	149982798	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATAGAGACTGGTCCTGCCTGC -3'
(R):5'- GGATCTTCTACTTCAGTGTGCC -3'

Sequencing Primer
(F):5'- GAGACTGGTCCTGCCTGCTATTC -3'
(R):5'- AGTGTGCCGCCCTTTGC -3'

Posted On

2015-07-21