Incidental Mutation 'R4432:Insc'
ID328654
Institutional Source Beutler Lab
Gene Symbol Insc
Ensembl Gene ENSMUSG00000048782
Gene NameINSC spindle orientation adaptor protein
SynonymsInscuteable, 3830422K02Rik
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4432 (G1)
Quality Score147
Status Validated
Chromosome7
Chromosomal Location114743694-114850383 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 114769055 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117543] [ENSMUST00000136645] [ENSMUST00000151464] [ENSMUST00000161800] [ENSMUST00000169913]
Predicted Effect probably benign
Transcript: ENSMUST00000117543
SMART Domains Protein: ENSMUSP00000112682
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
Pfam:INSC_LBD 23 69 8.3e-34 PFAM
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136347
Predicted Effect probably benign
Transcript: ENSMUST00000136645
SMART Domains Protein: ENSMUSP00000119459
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-19 PDB
low complexity region 60 78 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139670
Predicted Effect probably benign
Transcript: ENSMUST00000151464
SMART Domains Protein: ENSMUSP00000117296
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3SF4|F 20 53 8e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000161800
SMART Domains Protein: ENSMUSP00000125061
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3RO3|B 66 87 5e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169913
SMART Domains Protein: ENSMUSP00000129505
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-17 PDB
low complexity region 60 78 N/A INTRINSIC
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila, neuroblasts divide asymmetrically into another neuroblast at the apical side and a smaller ganglion mother cell on the basal side. Cell polarization is precisely regulated by 2 apically localized multiprotein signaling complexes that are tethered by Inscuteable, which regulates their apical localization (Izaki et al., 2006 [PubMed 16458856]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to abnormal cochlear hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Insc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Insc APN 7 114842154 missense probably damaging 1.00
IGL02381:Insc APN 7 114849942 makesense probably null
IGL02515:Insc APN 7 114769008 missense probably damaging 1.00
IGL03154:Insc APN 7 114842189 missense probably null 1.00
rare UTSW 7 114791148 missense probably damaging 1.00
R0139:Insc UTSW 7 114769002 missense probably damaging 0.98
R0322:Insc UTSW 7 114792265 missense probably damaging 0.99
R0708:Insc UTSW 7 114845146 missense probably damaging 0.98
R0715:Insc UTSW 7 114845077 missense probably benign 0.06
R1864:Insc UTSW 7 114842178 missense probably benign 0.06
R2069:Insc UTSW 7 114804593 critical splice donor site probably null
R3763:Insc UTSW 7 114790972 missense probably damaging 1.00
R5331:Insc UTSW 7 114845038 missense probably damaging 0.97
R5346:Insc UTSW 7 114804541 missense possibly damaging 0.69
R5625:Insc UTSW 7 114829067 missense probably damaging 0.99
R5715:Insc UTSW 7 114849841 missense probably benign 0.04
R5860:Insc UTSW 7 114791148 missense probably damaging 1.00
R6199:Insc UTSW 7 114791166 splice site probably null
R7137:Insc UTSW 7 114811615 missense probably benign 0.21
R7440:Insc UTSW 7 114845043 missense possibly damaging 0.78
R7474:Insc UTSW 7 114768823 critical splice donor site probably null
R7504:Insc UTSW 7 114791298 critical splice donor site probably null
R7964:Insc UTSW 7 114846473 missense probably damaging 1.00
R7981:Insc UTSW 7 114829067 missense probably damaging 0.99
R7997:Insc UTSW 7 114845137 missense probably damaging 1.00
Z1176:Insc UTSW 7 114811639 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGAGTGTGAATCAGCTC -3'
(R):5'- TGTGTGAACTTTCCAGCGGG -3'

Sequencing Primer
(F):5'- CTTAAGCCCAGATTTGAGAAGTG -3'
(R):5'- AACTTTCCAGCGGGTGCAG -3'
Posted On2015-07-21