Incidental Mutation 'R4432:Pcid2'
ID328656
Institutional Source Beutler Lab
Gene Symbol Pcid2
Ensembl Gene ENSMUSG00000038542
Gene NamePCI domain containing 2
Synonyms
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13077189-13105459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13085421 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 196 (D196G)
Ref Sequence ENSEMBL: ENSMUSP00000133204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000172443]
Predicted Effect probably damaging
Transcript: ENSMUST00000164416
AA Change: D196G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542
AA Change: D196G

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166881
Predicted Effect probably benign
Transcript: ENSMUST00000167198
Predicted Effect probably benign
Transcript: ENSMUST00000168164
Predicted Effect probably benign
Transcript: ENSMUST00000172443
Meta Mutation Damage Score 0.7139 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the TREX-2 complex (transcription and export complex 2), which regulates mRNA export from the nucleus. This protein regulates expression of Mad2 mitotic arrest deficient-like 1, a cell division checkpoint protein. This protein also interacts with and stabilizes Brca2 (breast cancer 2) protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygotes for a targeted null mutation implant, but die prior to embryonic day 7.5. Heterozygotes also exhibit excess embryonic loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Pcid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Pcid2 APN 8 13090660 missense probably damaging 1.00
IGL01526:Pcid2 APN 8 13085319 unclassified probably benign
IGL01603:Pcid2 APN 8 13079936 missense possibly damaging 0.49
IGL01867:Pcid2 APN 8 13078243 missense probably benign 0.06
raton UTSW 8 13085425 missense probably damaging 1.00
R0091:Pcid2 UTSW 8 13085392 missense probably benign 0.00
R0322:Pcid2 UTSW 8 13090775 intron probably benign
R0403:Pcid2 UTSW 8 13085367 missense probably damaging 1.00
R0426:Pcid2 UTSW 8 13081262 critical splice donor site probably null
R1914:Pcid2 UTSW 8 13094141 critical splice donor site probably null
R3498:Pcid2 UTSW 8 13100413 missense possibly damaging 0.46
R4832:Pcid2 UTSW 8 13085425 missense probably damaging 1.00
R5106:Pcid2 UTSW 8 13079648 missense probably damaging 1.00
R5169:Pcid2 UTSW 8 13079632 splice site probably null
R5788:Pcid2 UTSW 8 13100320 splice site probably null
R7048:Pcid2 UTSW 8 13078243 missense probably benign 0.06
R7219:Pcid2 UTSW 8 13079907 missense probably benign 0.01
R8322:Pcid2 UTSW 8 13078555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCTTATATTCTCTGCGACATC -3'
(R):5'- AGTCCAAGCTTCTCCATTGTATG -3'

Sequencing Primer
(F):5'- TCAATGTCAGTAAGGCAGAACAC -3'
(R):5'- CCATTGTATGTTGTCTGTACCAG -3'
Posted On2015-07-21