Incidental Mutation 'R4432:6430573F11Rik'
ID328657
Institutional Source Beutler Lab
Gene Symbol 6430573F11Rik
Ensembl Gene ENSMUSG00000039620
Gene NameRIKEN cDNA 6430573F11 gene
Synonyms
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4432 (G1)
Quality Score172
Status Validated
Chromosome8
Chromosomal Location36457548-36516570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36498478 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 51 (I51F)
Ref Sequence ENSEMBL: ENSMUSP00000127875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135373] [ENSMUST00000147525] [ENSMUST00000152039] [ENSMUST00000171777]
Predicted Effect probably damaging
Transcript: ENSMUST00000135373
AA Change: I51F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120524
Gene: ENSMUSG00000039620
AA Change: I51F

DomainStartEndE-ValueType
Pfam:Methyltransf_11 49 114 7.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147525
AA Change: I51F

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119912
Gene: ENSMUSG00000039620
AA Change: I51F

DomainStartEndE-ValueType
Pfam:Methyltransf_8 4 158 3.6e-9 PFAM
Pfam:Ubie_methyltran 9 153 2.9e-7 PFAM
Pfam:Methyltransf_23 23 184 4.2e-12 PFAM
Pfam:Methyltransf_31 42 186 1.3e-10 PFAM
Pfam:Methyltransf_25 48 135 4.2e-9 PFAM
Pfam:Methyltransf_12 49 137 4.1e-11 PFAM
Pfam:Methyltransf_11 49 139 3.6e-18 PFAM
low complexity region 377 387 N/A INTRINSIC
low complexity region 410 430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152039
AA Change: I51F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119288
Gene: ENSMUSG00000039620
AA Change: I51F

DomainStartEndE-ValueType
Pfam:Methyltransf_11 49 109 2.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171777
AA Change: I51F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127875
Gene: ENSMUSG00000039620
AA Change: I51F

DomainStartEndE-ValueType
Pfam:Methyltransf_8 4 158 3.6e-9 PFAM
Pfam:Ubie_methyltran 9 153 2.9e-7 PFAM
Pfam:Methyltransf_23 23 186 1.5e-11 PFAM
Pfam:Methyltransf_31 42 186 3.5e-10 PFAM
Pfam:Methyltransf_25 48 135 4.3e-9 PFAM
Pfam:Methyltransf_12 49 137 4.1e-11 PFAM
Pfam:Methyltransf_11 49 139 3.2e-18 PFAM
low complexity region 377 387 N/A INTRINSIC
low complexity region 410 430 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in 6430573F11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:6430573F11Rik APN 8 36512299 missense possibly damaging 0.90
IGL01360:6430573F11Rik APN 8 36512559 missense probably benign 0.08
IGL01364:6430573F11Rik APN 8 36512347 missense probably benign 0.03
IGL03401:6430573F11Rik APN 8 36505669 missense probably damaging 1.00
Bear_market UTSW 8 36498483 critical splice donor site probably null
R2161:6430573F11Rik UTSW 8 36505650 missense probably damaging 1.00
R2230:6430573F11Rik UTSW 8 36512553 missense probably damaging 1.00
R2232:6430573F11Rik UTSW 8 36512553 missense probably damaging 1.00
R4250:6430573F11Rik UTSW 8 36512212 missense probably benign 0.05
R4491:6430573F11Rik UTSW 8 36505606 missense probably damaging 1.00
R5242:6430573F11Rik UTSW 8 36511930 missense probably benign 0.02
R5261:6430573F11Rik UTSW 8 36511924 missense probably benign 0.07
R5482:6430573F11Rik UTSW 8 36512049 missense probably benign
R5579:6430573F11Rik UTSW 8 36512041 missense probably benign 0.00
R5594:6430573F11Rik UTSW 8 36512298 missense probably benign 0.00
R5797:6430573F11Rik UTSW 8 36498415 nonsense probably null
R6481:6430573F11Rik UTSW 8 36498483 critical splice donor site probably null
R7504:6430573F11Rik UTSW 8 36512155 missense probably benign 0.03
R8119:6430573F11Rik UTSW 8 36498422 nonsense probably null
R8169:6430573F11Rik UTSW 8 36511703 missense probably damaging 0.97
X0057:6430573F11Rik UTSW 8 36511988 nonsense probably null
X0065:6430573F11Rik UTSW 8 36511856 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGGGCTGAGCATGTACAAGG -3'
(R):5'- TGCAGACTTTGATGATGGCTG -3'

Sequencing Primer
(F):5'- GCATGTACAAGGCATCACATCTATG -3'
(R):5'- CACCGGGCTTCTTTTTAG -3'
Posted On2015-07-21