Incidental Mutation 'R4432:Casp4'
ID328659
Institutional Source Beutler Lab
Gene Symbol Casp4
Ensembl Gene ENSMUSG00000033538
Gene Namecaspase 4, apoptosis-related cysteine peptidase
SynonymsCasp11, Caspase-11, ich-3
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location5308828-5336783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5323653 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 74 (R74H)
Ref Sequence ENSEMBL: ENSMUSP00000124402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027012] [ENSMUST00000160064] [ENSMUST00000162846]
Predicted Effect probably damaging
Transcript: ENSMUST00000027012
AA Change: R130H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027012
Gene: ENSMUSG00000033538
AA Change: R130H

DomainStartEndE-ValueType
CARD 1 92 7.63e-7 SMART
CASc 121 371 5.72e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152651
Predicted Effect silent
Transcript: ENSMUST00000159461
SMART Domains Protein: ENSMUSP00000124535
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
SCOP:d1dgna_ 2 32 7e-7 SMART
Blast:CARD 2 40 9e-22 BLAST
Predicted Effect silent
Transcript: ENSMUST00000160064
SMART Domains Protein: ENSMUSP00000124249
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
CARD 1 89 4.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160521
Predicted Effect probably damaging
Transcript: ENSMUST00000162846
AA Change: R74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124402
Gene: ENSMUSG00000033538
AA Change: R74H

DomainStartEndE-ValueType
Blast:CARD 2 36 2e-17 BLAST
PDB:1IBC|A 18 94 6e-12 PDB
SCOP:g1ibc.1 45 94 6e-15 SMART
Blast:CASc 65 94 7e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163086
Meta Mutation Damage Score 0.5353 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine proteases that plays important roles in apoptosis, cell migration and the inflammatory response. The encoded protein mediates production of pro-inflammatory cytokines by macrophages upon bacterial infection. Mice lacking the encoded protein are resistant to endotoxic shock induced by lipopolysaccharide. A 5-bp deletion encompassing a splice acceptor junction resulting in alternate splicing and a shorter non-functional isoform in certain mouse strains has been described. Although its official nomenclature is "caspase 4, apoptosis-related cysteine peptidase", this gene and its encoded protein have historically been called caspase 11. This gene is present in a cluster of three caspase genes on chromosome 9. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in decreased levels of serum IL-1alpha and IL-1beta. Mutant animals are resistant to septic shock after injection with LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Casp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02688:Casp4 APN 9 5322844 missense possibly damaging 0.76
BB007:Casp4 UTSW 9 5321318 missense probably damaging 0.99
BB017:Casp4 UTSW 9 5321318 missense probably damaging 0.99
R1302:Casp4 UTSW 9 5328518 nonsense probably null
R1562:Casp4 UTSW 9 5324733 missense possibly damaging 0.69
R1716:Casp4 UTSW 9 5308919 splice site probably null
R2031:Casp4 UTSW 9 5321401 missense probably benign 0.00
R2655:Casp4 UTSW 9 5322894 missense possibly damaging 0.93
R4207:Casp4 UTSW 9 5328451 missense probably benign 0.15
R4911:Casp4 UTSW 9 5328580 unclassified probably benign
R5269:Casp4 UTSW 9 5321521 splice site probably benign
R5399:Casp4 UTSW 9 5324928 nonsense probably null
R5800:Casp4 UTSW 9 5308915 critical splice donor site probably null
R5895:Casp4 UTSW 9 5328573 unclassified probably benign
R6582:Casp4 UTSW 9 5324884 missense probably benign 0.01
R7253:Casp4 UTSW 9 5324868 missense probably benign 0.37
R7426:Casp4 UTSW 9 5321345 missense possibly damaging 0.87
R7930:Casp4 UTSW 9 5321318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGAACTTTGACTAGGTACTAAGG -3'
(R):5'- CAGTATAGGATGTTGCAGTGGC -3'

Sequencing Primer
(F):5'- TCTGTCTTTAGCCCTTGAGAAG -3'
(R):5'- AGTGGCTCTTACCTCTGCTGTAAG -3'
Posted On2015-07-21