Incidental Mutation 'R4432:Vmn1r218'
ID328666
Institutional Source Beutler Lab
Gene Symbol Vmn1r218
Ensembl Gene ENSMUSG00000115020
Gene Namevomeronasal 1 receptor 218
SynonymsV1ri5
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23133155-23146112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23137242 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 173 (F173S)
Ref Sequence ENSEMBL: ENSMUSP00000154769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074992] [ENSMUST00000226692] [ENSMUST00000227050] [ENSMUST00000227160] [ENSMUST00000227741]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074992
AA Change: F253S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074519
Gene: ENSMUSG00000115020
AA Change: F253S

DomainStartEndE-ValueType
Pfam:TAS2R 1 288 2e-7 PFAM
Pfam:V1R 33 297 5.4e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226692
AA Change: F253S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227050
AA Change: F253S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227160
AA Change: F173S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227741
AA Change: F173S

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228348
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Vmn1r218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02014:Vmn1r218 APN 13 23136831 missense probably damaging 0.97
IGL02670:Vmn1r218 APN 13 23137004 missense probably benign 0.01
IGL03085:Vmn1r218 APN 13 23137311 missense possibly damaging 0.76
IGL03334:Vmn1r218 APN 13 23136618 missense probably damaging 1.00
R0049:Vmn1r218 UTSW 13 23137055 nonsense probably null
R0049:Vmn1r218 UTSW 13 23137055 nonsense probably null
R1387:Vmn1r218 UTSW 13 23137308 missense probably damaging 1.00
R1959:Vmn1r218 UTSW 13 23136513 missense probably damaging 0.96
R3713:Vmn1r218 UTSW 13 23136911 missense probably damaging 1.00
R3714:Vmn1r218 UTSW 13 23136911 missense probably damaging 1.00
R4037:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R4038:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R4039:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R5255:Vmn1r218 UTSW 13 23136711 missense possibly damaging 0.92
R5521:Vmn1r218 UTSW 13 23136573 missense probably benign 0.01
R7384:Vmn1r218 UTSW 13 23136725 missense probably benign 0.00
R7565:Vmn1r218 UTSW 13 23136660 missense probably benign 0.05
R8178:Vmn1r218 UTSW 13 23137302 missense probably benign 0.08
R8536:Vmn1r218 UTSW 13 23137365 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGTCTAATGGGCTGGAGC -3'
(R):5'- TCCCCAACCCTAGAATTCATTAAGG -3'

Sequencing Primer
(F):5'- CAGTGGGTCCATGGCTCTC -3'
(R):5'- AACCCTAGAATTCATTAAGGTAAAGC -3'
Posted On2015-07-21