Incidental Mutation 'R4432:Phf11c'
ID328669
Institutional Source Beutler Lab
Gene Symbol Phf11c
Ensembl Gene ENSMUSG00000091144
Gene NamePHD finger protein 11C
SynonymsGm6907
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59380833-59395381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59390935 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 88 (N88K)
Ref Sequence ENSEMBL: ENSMUSP00000131536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166912
AA Change: N88K

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131536
Gene: ENSMUSG00000091144
AA Change: N88K

DomainStartEndE-ValueType
PHD 112 162 3.25e-4 SMART
low complexity region 178 186 N/A INTRINSIC
Meta Mutation Damage Score 0.1205 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Phf11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Phf11c APN 14 59389348 missense probably benign 0.07
IGL01080:Phf11c APN 14 59393199 missense probably benign 0.00
IGL01819:Phf11c APN 14 59393137 missense probably benign 0.00
IGL02691:Phf11c APN 14 59384787 missense probably damaging 1.00
R0029:Phf11c UTSW 14 59384915 missense probably benign 0.02
R0965:Phf11c UTSW 14 59381482 missense probably damaging 1.00
R3001:Phf11c UTSW 14 59384840 missense probably damaging 1.00
R3002:Phf11c UTSW 14 59384840 missense probably damaging 1.00
R3081:Phf11c UTSW 14 59381484 missense probably benign
R4230:Phf11c UTSW 14 59393067 missense probably benign 0.00
R5649:Phf11c UTSW 14 59385532 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGCTGATGTGTGCGACAG -3'
(R):5'- TGAGGCATTGTCCACTCTGC -3'

Sequencing Primer
(F):5'- CATGTGTCTGTGAAAGCCAGCAC -3'
(R):5'- TGCACTCCTCTGCAGCC -3'
Posted On2015-07-21