Incidental Mutation 'R4432:Slc1a1'
ID328673
Institutional Source Beutler Lab
Gene Symbol Slc1a1
Ensembl Gene ENSMUSG00000024935
Gene Namesolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
SynonymsD130048G10Rik, MEAAC1, EAAC1, EAAT3
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28835049-28913960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28902709 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 263 (F263S)
Ref Sequence ENSEMBL: ENSMUSP00000025875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025875] [ENSMUST00000175647] [ENSMUST00000179171]
Predicted Effect probably benign
Transcript: ENSMUST00000025875
AA Change: F263S

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025875
Gene: ENSMUSG00000024935
AA Change: F263S

DomainStartEndE-ValueType
Pfam:SDF 20 464 2.3e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162189
Predicted Effect probably benign
Transcript: ENSMUST00000175647
SMART Domains Protein: ENSMUSP00000135813
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
Pfam:SPATA6 6 78 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179171
SMART Domains Protein: ENSMUSP00000137486
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Meta Mutation Damage Score 0.4233 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced locomotor activity and excessive excretion of glutamate and aspartate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Slc1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Slc1a1 APN 19 28902753 missense possibly damaging 0.66
IGL02726:Slc1a1 APN 19 28911769 missense probably benign 0.04
IGL02865:Slc1a1 APN 19 28905338 missense probably damaging 1.00
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0490:Slc1a1 UTSW 19 28897531 missense probably benign
R1219:Slc1a1 UTSW 19 28904746 splice site probably benign
R1333:Slc1a1 UTSW 19 28835211 start gained probably benign
R1623:Slc1a1 UTSW 19 28904722 missense probably benign 0.09
R1669:Slc1a1 UTSW 19 28911794 missense probably benign 0.04
R1746:Slc1a1 UTSW 19 28894469 missense probably benign 0.31
R2516:Slc1a1 UTSW 19 28892912 missense probably benign 0.31
R4198:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4199:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4200:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4744:Slc1a1 UTSW 19 28894525 missense probably benign
R5110:Slc1a1 UTSW 19 28911808 missense probably benign 0.14
R5341:Slc1a1 UTSW 19 28897568 missense probably benign
R6136:Slc1a1 UTSW 19 28905410 missense probably damaging 1.00
R6153:Slc1a1 UTSW 19 28909535 missense probably damaging 0.98
R6640:Slc1a1 UTSW 19 28894570 critical splice donor site probably null
RF020:Slc1a1 UTSW 19 28879155 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCACACATTCTTACCAGAAC -3'
(R):5'- ATCCACCTACGGTACAGCTG -3'

Sequencing Primer
(F):5'- TCAAAGCTGAGCCCTTGG -3'
(R):5'- CCTACGGTACAGCTGTTAAAGGAC -3'
Posted On2015-07-21