Mutagenetix > Incidental Mutation

Incidental Mutation 'R4433:Zgrf1'

328684

Institutional Source

Beutler Lab

Gene Symbol

Zgrf1

Ensembl Gene

ENSMUSG00000051278

Gene Name

zinc finger, GRF-type containing 1

Synonyms

4930422G04Rik

MMRRC Submission

041147-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R4433 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127553489-127618023 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127562078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 318 (T318A)

Ref Sequence

ENSEMBL: ENSMUSP00000143585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000195955] [ENSMUST00000196141] [ENSMUST00000199888] [ENSMUST00000200490]

AlphaFold

Q0VGT4

Predicted Effect

probably benign
Transcript: ENSMUST00000043108
AA Change: T318A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: T318A

Domain	Start	End	E-Value	Type
Pfam:DUF2439	3	81	3.7e-23	PFAM
low complexity region	92	105	N/A	INTRINSIC
low complexity region	628	639	N/A	INTRINSIC
low complexity region	896	906	N/A	INTRINSIC
Pfam:zf-GRF	1109	1153	1.5e-17	PFAM
low complexity region	1316	1328	N/A	INTRINSIC
Pfam:AAA_11	1501	1608	1.6e-21	PFAM
Pfam:AAA_12	1616	1802	1.3e-51	PFAM
coiled coil region	1833	1861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195955
AA Change: T318A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142886
Gene: ENSMUSG00000051278
AA Change: T318A

Domain	Start	End	E-Value	Type
Pfam:DUF2439	3	82	1.6e-25	PFAM
low complexity region	92	105	N/A	INTRINSIC
low complexity region	628	639	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196141
AA Change: T318A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: T318A

Domain	Start	End	E-Value	Type
Pfam:DUF2439	3	81	3.7e-23	PFAM
low complexity region	92	105	N/A	INTRINSIC
low complexity region	628	639	N/A	INTRINSIC
low complexity region	896	906	N/A	INTRINSIC
Pfam:zf-GRF	1109	1153	1.5e-17	PFAM
low complexity region	1316	1328	N/A	INTRINSIC
Pfam:AAA_11	1501	1608	1.6e-21	PFAM
Pfam:AAA_12	1616	1802	1.3e-51	PFAM
coiled coil region	1833	1861	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196949

Predicted Effect

probably benign
Transcript: ENSMUST00000199888
AA Change: T318A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278
AA Change: T318A

Domain	Start	End	E-Value	Type
Pfam:DUF2439	3	82	3.5e-22	PFAM
low complexity region	92	105	N/A	INTRINSIC
low complexity region	628	639	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200490
AA Change: T318A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278
AA Change: T318A

Domain	Start	End	E-Value	Type
Pfam:DUF2439	3	81	3.4e-20	PFAM
low complexity region	92	105	N/A	INTRINSIC
low complexity region	628	639	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	T	16: 20,368,187		probably null	Het
Acsm2	A	G	7: 119,554,509	H14R	unknown	Het
Adamtsl4	T	C	3: 95,681,759		probably null	Het
Ak5	A	G	3: 152,655,880	I135T	probably damaging	Het
Alk	G	T	17: 71,899,241	S1038*	probably null	Het
Ank2	A	T	3: 126,947,806		probably benign	Het
Ap2m1	A	T	16: 20,543,384	H414L	possibly damaging	Het
Atp13a5	A	T	16: 29,282,024	M649K	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Cdc25b	A	G	2: 131,191,698	S186G	probably benign	Het
Ceacam16	A	G	7: 19,853,589	V418A	possibly damaging	Het
Cntnap3	A	C	13: 64,778,853	S568A	possibly damaging	Het
Col24a1	G	T	3: 145,314,383	V172F	possibly damaging	Het
E430018J23Rik	T	G	7: 127,393,002	Q87P	possibly damaging	Het
Eef2	CCC	CCCC	10: 81,178,768		probably null	Het
Esp36	T	A	17: 38,418,956	T15S	unknown	Het
Fam126a	A	C	5: 23,979,581	C218G	possibly damaging	Het
Fam26f	T	A	10: 34,127,831	T27S	probably damaging	Het
Fat2	A	T	11: 55,309,640	H869Q	possibly damaging	Het
Fat3	A	G	9: 16,031,152	V1308A	probably damaging	Het
Gimap3	T	C	6: 48,765,946	T17A	possibly damaging	Het
Hnrnpr	A	G	4: 136,317,148	K13R	probably benign	Het
Kdr	A	G	5: 75,943,925	M1133T	possibly damaging	Het
Mgarp	A	G	3: 51,396,260		probably benign	Het
Neto2	G	A	8: 85,641,083	T337I	probably damaging	Het
Nfib	C	T	4: 82,498,435	R137Q	probably damaging	Het
Nr3c2	A	G	8: 77,217,467	E890G	probably damaging	Het
Nsun4	A	G	4: 116,040,130	V228A	possibly damaging	Het
Nt5c1a	T	A	4: 123,215,896	S263T	probably benign	Het
Ntm	A	T	9: 29,012,220	Y45*	probably null	Het
Nts	A	G	10: 102,485,027	V67A	probably benign	Het
Olfr1288	T	A	2: 111,479,412	C209*	probably null	Het
Olfr378	A	T	11: 73,425,711	S91T	possibly damaging	Het
Olfr384	A	G	11: 73,602,886	Y102C	probably damaging	Het
Olfr610	T	A	7: 103,506,139	K269M	probably benign	Het
Ostm1	C	A	10: 42,679,123	A47E	probably benign	Het
Otol1	G	A	3: 70,018,548	V19M	probably benign	Het
Pcdhb15	A	G	18: 37,475,512	N599S	probably damaging	Het
Pcdhgb1	T	C	18: 37,681,251	I265T	probably damaging	Het
Pdzd3	T	C	9: 44,247,988	*499W	probably null	Het
Pex14	T	C	4: 148,961,510	E321G	possibly damaging	Het
Phactr3	C	A	2: 178,283,132	R251S	probably damaging	Het
Pkdcc	C	T	17: 83,221,141	T313M	probably benign	Het
Plce1	A	T	19: 38,767,301	E1911V	probably damaging	Het
Ptprv	G	T	1: 135,114,570		noncoding transcript	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rhob	A	G	12: 8,499,533	Y34H	possibly damaging	Het
Slc27a3	G	A	3: 90,387,340	T408M	probably damaging	Het
Slc9c1	A	T	16: 45,599,466	I1000F	possibly damaging	Het
Tcf7	G	T	11: 52,261,615	P36T	probably benign	Het
Tcf7l1	C	G	6: 72,788,769	E62Q	probably damaging	Het
Tctex1d4	C	T	4: 117,128,123	R48C	probably damaging	Het
Tll2	A	G	19: 41,121,348	S326P	probably benign	Het
Tubgcp4	A	G	2: 121,184,473	N288S	probably benign	Het
Zfhx3	G	A	8: 108,955,637	R3236H	unknown	Het

Other mutations in Zgrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Zgrf1	APN	3	127588141	splice site	probably benign
IGL01153:Zgrf1	APN	3	127602406	missense	probably damaging	1.00
IGL01330:Zgrf1	APN	3	127584007	missense	probably damaging	1.00
IGL01501:Zgrf1	APN	3	127602562	splice site	probably null
IGL01827:Zgrf1	APN	3	127616281	missense	probably benign	0.06
IGL02600:Zgrf1	APN	3	127600974	splice site	probably benign
IGL03122:Zgrf1	APN	3	127588133	missense	possibly damaging	0.91
IGL03365:Zgrf1	APN	3	127598774	missense	possibly damaging	0.48
R0015_Zgrf1_014	UTSW	3	127555397	splice site	probably benign
R1298_Zgrf1_204	UTSW	3	127583889	missense	possibly damaging	0.95
R7175_zgrf1_533	UTSW	3	127563590	missense	probably damaging	1.00
R0015:Zgrf1	UTSW	3	127555397	splice site	probably benign
R0243:Zgrf1	UTSW	3	127615446	missense	probably damaging	0.99
R0468:Zgrf1	UTSW	3	127562041	missense	possibly damaging	0.72
R0497:Zgrf1	UTSW	3	127584650	splice site	probably benign
R0505:Zgrf1	UTSW	3	127573238	missense	probably benign	0.30
R0511:Zgrf1	UTSW	3	127584660	missense	possibly damaging	0.93
R0539:Zgrf1	UTSW	3	127615192	missense	probably damaging	1.00
R0617:Zgrf1	UTSW	3	127588038	missense	probably benign	0.39
R1298:Zgrf1	UTSW	3	127583889	missense	possibly damaging	0.95
R1353:Zgrf1	UTSW	3	127611803	missense	probably damaging	1.00
R1593:Zgrf1	UTSW	3	127561026	missense	possibly damaging	0.86
R1846:Zgrf1	UTSW	3	127615463	missense	probably damaging	1.00
R1912:Zgrf1	UTSW	3	127563137	missense	probably benign
R2062:Zgrf1	UTSW	3	127613350	missense	probably damaging	1.00
R2064:Zgrf1	UTSW	3	127613350	missense	probably damaging	1.00
R2065:Zgrf1	UTSW	3	127613350	missense	probably damaging	1.00
R2066:Zgrf1	UTSW	3	127613350	missense	probably damaging	1.00
R2067:Zgrf1	UTSW	3	127613350	missense	probably damaging	1.00
R2256:Zgrf1	UTSW	3	127561997	missense	probably benign	0.18
R2321:Zgrf1	UTSW	3	127562407	nonsense	probably null
R2381:Zgrf1	UTSW	3	127556214	missense	probably benign	0.02
R2913:Zgrf1	UTSW	3	127598707	missense	possibly damaging	0.65
R3147:Zgrf1	UTSW	3	127584148	missense	possibly damaging	0.84
R3236:Zgrf1	UTSW	3	127613375	missense	probably damaging	1.00
R3237:Zgrf1	UTSW	3	127613375	missense	probably damaging	1.00
R4441:Zgrf1	UTSW	3	127586137	missense	possibly damaging	0.45
R4457:Zgrf1	UTSW	3	127595929	missense	probably damaging	1.00
R4498:Zgrf1	UTSW	3	127586100	nonsense	probably null
R4598:Zgrf1	UTSW	3	127601030	missense	probably benign	0.14
R4701:Zgrf1	UTSW	3	127598704	missense	probably benign	0.03
R4898:Zgrf1	UTSW	3	127602436	missense	probably damaging	1.00
R4944:Zgrf1	UTSW	3	127561868	nonsense	probably null
R5256:Zgrf1	UTSW	3	127602445	missense	probably damaging	1.00
R5294:Zgrf1	UTSW	3	127600980	missense	probably benign	0.14
R5358:Zgrf1	UTSW	3	127567703	critical splice donor site	probably null
R5359:Zgrf1	UTSW	3	127601165	missense	possibly damaging	0.95
R5447:Zgrf1	UTSW	3	127563119	missense	possibly damaging	0.73
R5569:Zgrf1	UTSW	3	127561025	missense	probably benign	0.33
R5887:Zgrf1	UTSW	3	127584765	missense	probably damaging	1.00
R5914:Zgrf1	UTSW	3	127561023	missense	probably damaging	0.99
R5925:Zgrf1	UTSW	3	127573204	missense	possibly damaging	0.84
R5936:Zgrf1	UTSW	3	127562253	missense	possibly damaging	0.72
R6087:Zgrf1	UTSW	3	127615486	missense	probably damaging	1.00
R6089:Zgrf1	UTSW	3	127595993	missense	probably damaging	1.00
R6181:Zgrf1	UTSW	3	127587941	missense	probably damaging	1.00
R6277:Zgrf1	UTSW	3	127598812	missense	possibly damaging	0.81
R6441:Zgrf1	UTSW	3	127588034	missense	possibly damaging	0.93
R6659:Zgrf1	UTSW	3	127616506	missense	probably damaging	0.99
R6857:Zgrf1	UTSW	3	127581447	missense	probably damaging	0.99
R6932:Zgrf1	UTSW	3	127559632	critical splice donor site	probably null
R7008:Zgrf1	UTSW	3	127561772	missense	probably benign	0.18
R7175:Zgrf1	UTSW	3	127563590	missense	probably damaging	1.00
R7264:Zgrf1	UTSW	3	127563569	missense	probably benign	0.00
R7272:Zgrf1	UTSW	3	127598760	missense	probably damaging	0.99
R7298:Zgrf1	UTSW	3	127583650	nonsense	probably null
R7412:Zgrf1	UTSW	3	127563071	missense	probably benign	0.06
R7836:Zgrf1	UTSW	3	127563431	missense	probably damaging	0.96
R7945:Zgrf1	UTSW	3	127562760	missense	probably benign	0.37
R7996:Zgrf1	UTSW	3	127595924	missense	possibly damaging	0.94
R8165:Zgrf1	UTSW	3	127563383	missense	possibly damaging	0.76
R8198:Zgrf1	UTSW	3	127596024	critical splice donor site	probably null
R8296:Zgrf1	UTSW	3	127583995	missense	probably damaging	0.99
R8298:Zgrf1	UTSW	3	127615229	missense	probably damaging	1.00
R8341:Zgrf1	UTSW	3	127560915	nonsense	probably null
R8445:Zgrf1	UTSW	3	127586205	critical splice donor site	probably null
R9088:Zgrf1	UTSW	3	127583677	missense	probably benign	0.21
R9236:Zgrf1	UTSW	3	127584663	missense	probably benign	0.09
R9250:Zgrf1	UTSW	3	127586148	missense	probably damaging	1.00
R9253:Zgrf1	UTSW	3	127598779	missense	probably damaging	1.00
R9464:Zgrf1	UTSW	3	127584092	missense	probably benign	0.03
R9647:Zgrf1	UTSW	3	127561602	missense	probably benign	0.02
R9680:Zgrf1	UTSW	3	127615567	missense	probably benign	0.38
RF015:Zgrf1	UTSW	3	127563233	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TAGACTCTCACTGTCCTGGAG -3'
(R):5'- ACTGGCTTGTCCTCACTGTG -3'

Sequencing Primer
(F):5'- GCAAAGCCCAGATATTAGCTCTTCTG -3'
(R):5'- GTGTAATTCTCCCTTTTTGGAACATG -3'

Posted On

2015-07-21