Mutagenetix > Incidental Mutation

Incidental Mutation 'R4433:Col24a1'

328685

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

041147-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4433 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 145314383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 172 (V172F)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029848
AA Change: V172F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: V172F

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139001

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	T	16: 20,368,187		probably null	Het
Acsm2	A	G	7: 119,554,509	H14R	unknown	Het
Adamtsl4	T	C	3: 95,681,759		probably null	Het
Ak5	A	G	3: 152,655,880	I135T	probably damaging	Het
Alk	G	T	17: 71,899,241	S1038*	probably null	Het
Ank2	A	T	3: 126,947,806		probably benign	Het
Ap2m1	A	T	16: 20,543,384	H414L	possibly damaging	Het
Atp13a5	A	T	16: 29,282,024	M649K	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Cdc25b	A	G	2: 131,191,698	S186G	probably benign	Het
Ceacam16	A	G	7: 19,853,589	V418A	possibly damaging	Het
Cntnap3	A	C	13: 64,778,853	S568A	possibly damaging	Het
E430018J23Rik	T	G	7: 127,393,002	Q87P	possibly damaging	Het
Eef2	CCC	CCCC	10: 81,178,768		probably null	Het
Esp36	T	A	17: 38,418,956	T15S	unknown	Het
Fam126a	A	C	5: 23,979,581	C218G	possibly damaging	Het
Fam26f	T	A	10: 34,127,831	T27S	probably damaging	Het
Fat2	A	T	11: 55,309,640	H869Q	possibly damaging	Het
Fat3	A	G	9: 16,031,152	V1308A	probably damaging	Het
Gimap3	T	C	6: 48,765,946	T17A	possibly damaging	Het
Hnrnpr	A	G	4: 136,317,148	K13R	probably benign	Het
Kdr	A	G	5: 75,943,925	M1133T	possibly damaging	Het
Mgarp	A	G	3: 51,396,260		probably benign	Het
Neto2	G	A	8: 85,641,083	T337I	probably damaging	Het
Nfib	C	T	4: 82,498,435	R137Q	probably damaging	Het
Nr3c2	A	G	8: 77,217,467	E890G	probably damaging	Het
Nsun4	A	G	4: 116,040,130	V228A	possibly damaging	Het
Nt5c1a	T	A	4: 123,215,896	S263T	probably benign	Het
Ntm	A	T	9: 29,012,220	Y45*	probably null	Het
Nts	A	G	10: 102,485,027	V67A	probably benign	Het
Olfr1288	T	A	2: 111,479,412	C209*	probably null	Het
Olfr378	A	T	11: 73,425,711	S91T	possibly damaging	Het
Olfr384	A	G	11: 73,602,886	Y102C	probably damaging	Het
Olfr610	T	A	7: 103,506,139	K269M	probably benign	Het
Ostm1	C	A	10: 42,679,123	A47E	probably benign	Het
Otol1	G	A	3: 70,018,548	V19M	probably benign	Het
Pcdhb15	A	G	18: 37,475,512	N599S	probably damaging	Het
Pcdhgb1	T	C	18: 37,681,251	I265T	probably damaging	Het
Pdzd3	T	C	9: 44,247,988	*499W	probably null	Het
Pex14	T	C	4: 148,961,510	E321G	possibly damaging	Het
Phactr3	C	A	2: 178,283,132	R251S	probably damaging	Het
Pkdcc	C	T	17: 83,221,141	T313M	probably benign	Het
Plce1	A	T	19: 38,767,301	E1911V	probably damaging	Het
Ptprv	G	T	1: 135,114,570		noncoding transcript	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rhob	A	G	12: 8,499,533	Y34H	possibly damaging	Het
Slc27a3	G	A	3: 90,387,340	T408M	probably damaging	Het
Slc9c1	A	T	16: 45,599,466	I1000F	possibly damaging	Het
Tcf7	G	T	11: 52,261,615	P36T	probably benign	Het
Tcf7l1	C	G	6: 72,788,769	E62Q	probably damaging	Het
Tctex1d4	C	T	4: 117,128,123	R48C	probably damaging	Het
Tll2	A	G	19: 41,121,348	S326P	probably benign	Het
Tubgcp4	A	G	2: 121,184,473	N288S	probably benign	Het
Zfhx3	G	A	8: 108,955,637	R3236H	unknown	Het
Zgrf1	A	G	3: 127,562,078	T318A	probably benign	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTTGCAATCATTCAAAGTGAAC -3'
(R):5'- CTGAGGCACTGCTGTTTCAG -3'

Sequencing Primer
(F):5'- GTGAACAATGCATTTCTCTTCAGC -3'
(R):5'- AGGTGTCTGCAATACTCCGC -3'

Posted On

2015-07-21