Incidental Mutation 'R4433:Hnrnpr'
ID 328691
Institutional Source Beutler Lab
Gene Symbol Hnrnpr
Ensembl Gene ENSMUSG00000066037
Gene Name heterogeneous nuclear ribonucleoprotein R
Synonyms hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik
MMRRC Submission 041147-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4433 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 136310942-136359447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136317148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 13 (K13R)
Ref Sequence ENSEMBL: ENSMUSP00000138263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000125696] [ENSMUST00000131671] [ENSMUST00000134524] [ENSMUST00000145282] [ENSMUST00000148843] [ENSMUST00000156259]
AlphaFold Q8VHM5
Predicted Effect probably benign
Transcript: ENSMUST00000084219
AA Change: K13R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: K13R

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105850
AA Change: K114R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: K114R

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125696
AA Change: K13R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000131671
AA Change: K13R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: K13R

DomainStartEndE-ValueType
RRM 65 139 1.27e-16 SMART
RRM 146 223 9.42e-11 SMART
RRM 241 306 3.76e-19 SMART
low complexity region 318 327 N/A INTRINSIC
low complexity region 332 395 N/A INTRINSIC
low complexity region 398 426 N/A INTRINSIC
low complexity region 430 473 N/A INTRINSIC
low complexity region 503 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134524
AA Change: K114R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000119666
Gene: ENSMUSG00000066037
AA Change: K114R

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145282
Predicted Effect probably benign
Transcript: ENSMUST00000148843
AA Change: K114R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: K114R

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156259
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,368,187 probably null Het
Acsm2 A G 7: 119,554,509 H14R unknown Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ak5 A G 3: 152,655,880 I135T probably damaging Het
Alk G T 17: 71,899,241 S1038* probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Ap2m1 A T 16: 20,543,384 H414L possibly damaging Het
Atp13a5 A T 16: 29,282,024 M649K probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc25b A G 2: 131,191,698 S186G probably benign Het
Ceacam16 A G 7: 19,853,589 V418A possibly damaging Het
Cntnap3 A C 13: 64,778,853 S568A possibly damaging Het
Col24a1 G T 3: 145,314,383 V172F possibly damaging Het
E430018J23Rik T G 7: 127,393,002 Q87P possibly damaging Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Esp36 T A 17: 38,418,956 T15S unknown Het
Fam126a A C 5: 23,979,581 C218G possibly damaging Het
Fam26f T A 10: 34,127,831 T27S probably damaging Het
Fat2 A T 11: 55,309,640 H869Q possibly damaging Het
Fat3 A G 9: 16,031,152 V1308A probably damaging Het
Gimap3 T C 6: 48,765,946 T17A possibly damaging Het
Kdr A G 5: 75,943,925 M1133T possibly damaging Het
Mgarp A G 3: 51,396,260 probably benign Het
Neto2 G A 8: 85,641,083 T337I probably damaging Het
Nfib C T 4: 82,498,435 R137Q probably damaging Het
Nr3c2 A G 8: 77,217,467 E890G probably damaging Het
Nsun4 A G 4: 116,040,130 V228A possibly damaging Het
Nt5c1a T A 4: 123,215,896 S263T probably benign Het
Ntm A T 9: 29,012,220 Y45* probably null Het
Nts A G 10: 102,485,027 V67A probably benign Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Olfr378 A T 11: 73,425,711 S91T possibly damaging Het
Olfr384 A G 11: 73,602,886 Y102C probably damaging Het
Olfr610 T A 7: 103,506,139 K269M probably benign Het
Ostm1 C A 10: 42,679,123 A47E probably benign Het
Otol1 G A 3: 70,018,548 V19M probably benign Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcdhgb1 T C 18: 37,681,251 I265T probably damaging Het
Pdzd3 T C 9: 44,247,988 *499W probably null Het
Pex14 T C 4: 148,961,510 E321G possibly damaging Het
Phactr3 C A 2: 178,283,132 R251S probably damaging Het
Pkdcc C T 17: 83,221,141 T313M probably benign Het
Plce1 A T 19: 38,767,301 E1911V probably damaging Het
Ptprv G T 1: 135,114,570 noncoding transcript Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rhob A G 12: 8,499,533 Y34H possibly damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc9c1 A T 16: 45,599,466 I1000F possibly damaging Het
Tcf7 G T 11: 52,261,615 P36T probably benign Het
Tcf7l1 C G 6: 72,788,769 E62Q probably damaging Het
Tctex1d4 C T 4: 117,128,123 R48C probably damaging Het
Tll2 A G 19: 41,121,348 S326P probably benign Het
Tubgcp4 A G 2: 121,184,473 N288S probably benign Het
Zfhx3 G A 8: 108,955,637 R3236H unknown Het
Zgrf1 A G 3: 127,562,078 T318A probably benign Het
Other mutations in Hnrnpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Hnrnpr APN 4 136339545 missense unknown
IGL00844:Hnrnpr APN 4 136339205 missense probably benign 0.17
IGL01374:Hnrnpr APN 4 136327418 splice site probably benign
IGL01704:Hnrnpr APN 4 136329381 missense possibly damaging 0.89
IGL01825:Hnrnpr APN 4 136339539 nonsense probably null
IGL01843:Hnrnpr APN 4 136339413 splice site probably benign
IGL01871:Hnrnpr APN 4 136339574 missense unknown
IGL02376:Hnrnpr APN 4 136319455 missense probably damaging 1.00
IGL02557:Hnrnpr APN 4 136319506 missense probably damaging 1.00
IGL02947:Hnrnpr APN 4 136316379 missense probably damaging 1.00
PIT4677001:Hnrnpr UTSW 4 136329439 missense probably damaging 1.00
R0142:Hnrnpr UTSW 4 136327282 missense probably damaging 1.00
R0219:Hnrnpr UTSW 4 136339163 splice site probably benign
R1459:Hnrnpr UTSW 4 136329444 missense probably damaging 1.00
R1917:Hnrnpr UTSW 4 136332488 nonsense probably null
R2007:Hnrnpr UTSW 4 136319513 unclassified probably benign
R2364:Hnrnpr UTSW 4 136327329 missense possibly damaging 0.69
R3788:Hnrnpr UTSW 4 136336313 missense probably damaging 1.00
R4066:Hnrnpr UTSW 4 136339346 intron probably benign
R4232:Hnrnpr UTSW 4 136339189 missense probably benign 0.15
R4664:Hnrnpr UTSW 4 136317175 unclassified probably benign
R4990:Hnrnpr UTSW 4 136329379 missense probably damaging 1.00
R4990:Hnrnpr UTSW 4 136336298 missense probably damaging 1.00
R5058:Hnrnpr UTSW 4 136336337 missense possibly damaging 0.89
R5328:Hnrnpr UTSW 4 136339216 missense probably benign 0.01
R5469:Hnrnpr UTSW 4 136319434 missense probably damaging 1.00
R5641:Hnrnpr UTSW 4 136332487 missense probably damaging 0.97
R7067:Hnrnpr UTSW 4 136327393 missense probably damaging 1.00
R7250:Hnrnpr UTSW 4 136332435 missense probably benign 0.45
R7254:Hnrnpr UTSW 4 136332575 missense possibly damaging 0.92
R8213:Hnrnpr UTSW 4 136317175 unclassified probably benign
R8942:Hnrnpr UTSW 4 136332480 missense possibly damaging 0.95
R9008:Hnrnpr UTSW 4 136329426 missense probably damaging 0.97
R9502:Hnrnpr UTSW 4 136329370 missense probably damaging 0.99
R9515:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
R9516:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACTTACTGTCTGCTCCAG -3'
(R):5'- TAGAATACCACAGCTCTTCCCTAAG -3'

Sequencing Primer
(F):5'- CCTCAGGCATGTCAAAGTATTTG -3'
(R):5'- CCAGGCCAGTTTGAGCTACATAATG -3'
Posted On 2015-07-21