Incidental Mutation 'R4433:Pdzd3'
ID328705
Institutional Source Beutler Lab
Gene Symbol Pdzd3
Ensembl Gene ENSMUSG00000032105
Gene NamePDZ domain containing 3
Synonymssodium-phosphate cotransporter IIa C-terminal-associated protein 2, Pdzk2, NaPi-Cap2
MMRRC Submission 041147-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4433 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44247307-44251471 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 44247988 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 499 (*499W)
Ref Sequence ENSEMBL: ENSMUSP00000034618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034618] [ENSMUST00000034621] [ENSMUST00000092426] [ENSMUST00000168499] [ENSMUST00000169651] [ENSMUST00000213891] [ENSMUST00000215554] [ENSMUST00000215711] [ENSMUST00000216632] [ENSMUST00000217221] [ENSMUST00000217510]
Predicted Effect probably null
Transcript: ENSMUST00000034618
AA Change: *499W
SMART Domains Protein: ENSMUSP00000034618
Gene: ENSMUSG00000032105
AA Change: *499W

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PDZ 58 130 2.04e-15 SMART
PDZ 165 235 2.93e-7 SMART
PDZ 271 346 2.47e-14 SMART
PDZ 403 475 1.4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034621
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092426
SMART Domains Protein: ENSMUSP00000090082
Gene: ENSMUSG00000070306

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
coiled coil region 26 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168499
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213186
Predicted Effect probably benign
Transcript: ENSMUST00000213891
Predicted Effect probably benign
Transcript: ENSMUST00000215554
Predicted Effect probably benign
Transcript: ENSMUST00000215711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216047
Predicted Effect probably benign
Transcript: ENSMUST00000216632
Predicted Effect probably benign
Transcript: ENSMUST00000217221
Predicted Effect probably benign
Transcript: ENSMUST00000217510
Meta Mutation Damage Score 0.8214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclase C (GCC, or GUCY2C; MIM 601330) produces cGMP following the binding of either endogenous ligands or heat-stable enterotoxins secreted by E. coli and other enteric bacteria. Activation of GCC initiates a signaling cascade that leads to phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR; MIM 602421), followed by a net efflux of ions and water into the intestinal lumen. IKEPP is a regulatory protein that associates with GCC and regulates the amount of cGMP produced following receptor stimulation (Scott et al., 2002 [PubMed 11950846]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,368,187 probably null Het
Acsm2 A G 7: 119,554,509 H14R unknown Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ak5 A G 3: 152,655,880 I135T probably damaging Het
Alk G T 17: 71,899,241 S1038* probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Ap2m1 A T 16: 20,543,384 H414L possibly damaging Het
Atp13a5 A T 16: 29,282,024 M649K probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc25b A G 2: 131,191,698 S186G probably benign Het
Ceacam16 A G 7: 19,853,589 V418A possibly damaging Het
Cntnap3 A C 13: 64,778,853 S568A possibly damaging Het
Col24a1 G T 3: 145,314,383 V172F possibly damaging Het
E430018J23Rik T G 7: 127,393,002 Q87P possibly damaging Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Esp36 T A 17: 38,418,956 T15S unknown Het
Fam126a A C 5: 23,979,581 C218G possibly damaging Het
Fam26f T A 10: 34,127,831 T27S probably damaging Het
Fat2 A T 11: 55,309,640 H869Q possibly damaging Het
Fat3 A G 9: 16,031,152 V1308A probably damaging Het
Gimap3 T C 6: 48,765,946 T17A possibly damaging Het
Hnrnpr A G 4: 136,317,148 K13R probably benign Het
Kdr A G 5: 75,943,925 M1133T possibly damaging Het
Mgarp A G 3: 51,396,260 probably benign Het
Neto2 G A 8: 85,641,083 T337I probably damaging Het
Nfib C T 4: 82,498,435 R137Q probably damaging Het
Nr3c2 A G 8: 77,217,467 E890G probably damaging Het
Nsun4 A G 4: 116,040,130 V228A possibly damaging Het
Nt5c1a T A 4: 123,215,896 S263T probably benign Het
Ntm A T 9: 29,012,220 Y45* probably null Het
Nts A G 10: 102,485,027 V67A probably benign Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Olfr378 A T 11: 73,425,711 S91T possibly damaging Het
Olfr384 A G 11: 73,602,886 Y102C probably damaging Het
Olfr610 T A 7: 103,506,139 K269M probably benign Het
Ostm1 C A 10: 42,679,123 A47E probably benign Het
Otol1 G A 3: 70,018,548 V19M probably benign Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcdhgb1 T C 18: 37,681,251 I265T probably damaging Het
Pex14 T C 4: 148,961,510 E321G possibly damaging Het
Phactr3 C A 2: 178,283,132 R251S probably damaging Het
Pkdcc C T 17: 83,221,141 T313M probably benign Het
Plce1 A T 19: 38,767,301 E1911V probably damaging Het
Ptprv G T 1: 135,114,570 noncoding transcript Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rhob A G 12: 8,499,533 Y34H possibly damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc9c1 A T 16: 45,599,466 I1000F possibly damaging Het
Tcf7 G T 11: 52,261,615 P36T probably benign Het
Tcf7l1 C G 6: 72,788,769 E62Q probably damaging Het
Tctex1d4 C T 4: 117,128,123 R48C probably damaging Het
Tll2 A G 19: 41,121,348 S326P probably benign Het
Tubgcp4 A G 2: 121,184,473 N288S probably benign Het
Zfhx3 G A 8: 108,955,637 R3236H unknown Het
Zgrf1 A G 3: 127,562,078 T318A probably benign Het
Other mutations in Pdzd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Pdzd3 APN 9 44249636 missense possibly damaging 0.84
IGL01639:Pdzd3 APN 9 44248679 missense probably benign 0.41
IGL02210:Pdzd3 APN 9 44248317 missense probably benign
IGL02502:Pdzd3 APN 9 44249651 missense probably benign
IGL03082:Pdzd3 APN 9 44250786 missense possibly damaging 0.65
R0543:Pdzd3 UTSW 9 44248934 missense probably damaging 1.00
R1180:Pdzd3 UTSW 9 44249246 missense probably benign 0.38
R1919:Pdzd3 UTSW 9 44250303 missense possibly damaging 0.83
R4019:Pdzd3 UTSW 9 44250820 unclassified probably null
R4020:Pdzd3 UTSW 9 44250820 unclassified probably null
R4296:Pdzd3 UTSW 9 44248861 missense probably benign 0.01
R4430:Pdzd3 UTSW 9 44249744 missense probably benign
R4567:Pdzd3 UTSW 9 44249026 missense possibly damaging 0.90
R4942:Pdzd3 UTSW 9 44248618 nonsense probably null
R5436:Pdzd3 UTSW 9 44248355 missense possibly damaging 0.79
R6320:Pdzd3 UTSW 9 44248683 missense probably benign 0.00
R6688:Pdzd3 UTSW 9 44248230 critical splice donor site probably null
R7625:Pdzd3 UTSW 9 44250297 missense probably damaging 1.00
R8142:Pdzd3 UTSW 9 44250781 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATAGCATCCTGTGGCGTCTC -3'
(R):5'- GCCTGGATTTCCTTGGAGTC -3'

Sequencing Primer
(F):5'- CTCTGCTGGAGGTAGGCTC -3'
(R):5'- CTAACGGGTCGAGCTGTG -3'
Posted On2015-07-21