Incidental Mutation 'R4433:Eef2'
ID328708
Institutional Source Beutler Lab
Gene Symbol Eef2
Ensembl Gene ENSMUSG00000034994
Gene Nameeukaryotic translation elongation factor 2
SynonymsEf-2
MMRRC Submission 041147-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4433 (G1)
Quality Score144
Status Not validated
Chromosome10
Chromosomal Location81176631-81182498 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CCC to CCCC at 81178768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]
Predicted Effect probably benign
Transcript: ENSMUST00000047665
SMART Domains Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047864
SMART Domains Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 360 2e-65 PFAM
Pfam:MMR_HSR1 21 159 6.3e-6 PFAM
Pfam:GTP_EFTU_D2 409 486 2.3e-14 PFAM
Pfam:EFG_II 501 568 1.9e-14 PFAM
EFG_IV 621 737 5.56e-27 SMART
EFG_C 739 828 4.06e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056086
SMART Domains Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082507
Predicted Effect probably benign
Transcript: ENSMUST00000178422
SMART Domains Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217936
Predicted Effect probably benign
Transcript: ENSMUST00000218157
Predicted Effect probably benign
Transcript: ENSMUST00000219133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,368,187 probably null Het
Acsm2 A G 7: 119,554,509 H14R unknown Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ak5 A G 3: 152,655,880 I135T probably damaging Het
Alk G T 17: 71,899,241 S1038* probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Ap2m1 A T 16: 20,543,384 H414L possibly damaging Het
Atp13a5 A T 16: 29,282,024 M649K probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc25b A G 2: 131,191,698 S186G probably benign Het
Ceacam16 A G 7: 19,853,589 V418A possibly damaging Het
Cntnap3 A C 13: 64,778,853 S568A possibly damaging Het
Col24a1 G T 3: 145,314,383 V172F possibly damaging Het
E430018J23Rik T G 7: 127,393,002 Q87P possibly damaging Het
Esp36 T A 17: 38,418,956 T15S unknown Het
Fam126a A C 5: 23,979,581 C218G possibly damaging Het
Fam26f T A 10: 34,127,831 T27S probably damaging Het
Fat2 A T 11: 55,309,640 H869Q possibly damaging Het
Fat3 A G 9: 16,031,152 V1308A probably damaging Het
Gimap3 T C 6: 48,765,946 T17A possibly damaging Het
Hnrnpr A G 4: 136,317,148 K13R probably benign Het
Kdr A G 5: 75,943,925 M1133T possibly damaging Het
Mgarp A G 3: 51,396,260 probably benign Het
Neto2 G A 8: 85,641,083 T337I probably damaging Het
Nfib C T 4: 82,498,435 R137Q probably damaging Het
Nr3c2 A G 8: 77,217,467 E890G probably damaging Het
Nsun4 A G 4: 116,040,130 V228A possibly damaging Het
Nt5c1a T A 4: 123,215,896 S263T probably benign Het
Ntm A T 9: 29,012,220 Y45* probably null Het
Nts A G 10: 102,485,027 V67A probably benign Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Olfr378 A T 11: 73,425,711 S91T possibly damaging Het
Olfr384 A G 11: 73,602,886 Y102C probably damaging Het
Olfr610 T A 7: 103,506,139 K269M probably benign Het
Ostm1 C A 10: 42,679,123 A47E probably benign Het
Otol1 G A 3: 70,018,548 V19M probably benign Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcdhgb1 T C 18: 37,681,251 I265T probably damaging Het
Pdzd3 T C 9: 44,247,988 *499W probably null Het
Pex14 T C 4: 148,961,510 E321G possibly damaging Het
Phactr3 C A 2: 178,283,132 R251S probably damaging Het
Pkdcc C T 17: 83,221,141 T313M probably benign Het
Plce1 A T 19: 38,767,301 E1911V probably damaging Het
Ptprv G T 1: 135,114,570 noncoding transcript Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rhob A G 12: 8,499,533 Y34H possibly damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc9c1 A T 16: 45,599,466 I1000F possibly damaging Het
Tcf7 G T 11: 52,261,615 P36T probably benign Het
Tcf7l1 C G 6: 72,788,769 E62Q probably damaging Het
Tctex1d4 C T 4: 117,128,123 R48C probably damaging Het
Tll2 A G 19: 41,121,348 S326P probably benign Het
Tubgcp4 A G 2: 121,184,473 N288S probably benign Het
Zfhx3 G A 8: 108,955,637 R3236H unknown Het
Zgrf1 A G 3: 127,562,078 T318A probably benign Het
Other mutations in Eef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Eef2 APN 10 81181943 missense possibly damaging 0.93
IGL01303:Eef2 APN 10 81181982 splice site probably null
IGL01376:Eef2 APN 10 81178049 unclassified probably benign
IGL01876:Eef2 APN 10 81180270 missense probably benign
IGL02000:Eef2 APN 10 81180011 missense probably benign 0.13
IGL02514:Eef2 APN 10 81179593 missense probably benign 0.11
IGL03087:Eef2 APN 10 81181247 missense probably benign 0.12
IGL03389:Eef2 APN 10 81179706 missense probably benign 0.40
fig UTSW 10 81180292 missense possibly damaging 0.50
R0052:Eef2 UTSW 10 81178768 frame shift probably null
R0178:Eef2 UTSW 10 81180292 missense possibly damaging 0.50
R0445:Eef2 UTSW 10 81178770 frame shift probably null
R0497:Eef2 UTSW 10 81181586 missense probably benign 0.00
R0539:Eef2 UTSW 10 81178768 frame shift probably null
R0745:Eef2 UTSW 10 81181996 missense probably benign 0.00
R0811:Eef2 UTSW 10 81178769 frame shift probably null
R0812:Eef2 UTSW 10 81178769 frame shift probably null
R0832:Eef2 UTSW 10 81178769 frame shift probably null
R1136:Eef2 UTSW 10 81178769 frame shift probably null
R1298:Eef2 UTSW 10 81178768 frame shift probably null
R1549:Eef2 UTSW 10 81178768 frame shift probably null
R1550:Eef2 UTSW 10 81180847 missense probably benign 0.04
R2869:Eef2 UTSW 10 81178767 frame shift probably null
R2870:Eef2 UTSW 10 81178767 frame shift probably null
R2871:Eef2 UTSW 10 81178767 frame shift probably null
R2872:Eef2 UTSW 10 81178767 frame shift probably null
R3408:Eef2 UTSW 10 81178767 frame shift probably null
R3414:Eef2 UTSW 10 81177858 missense probably damaging 0.98
R4291:Eef2 UTSW 10 81179580 missense probably benign 0.00
R4357:Eef2 UTSW 10 81178767 frame shift probably null
R4577:Eef2 UTSW 10 81178767 frame shift probably null
R5154:Eef2 UTSW 10 81178767 frame shift probably null
R5609:Eef2 UTSW 10 81178769 frame shift probably null
R6545:Eef2 UTSW 10 81181114 missense probably damaging 1.00
R6649:Eef2 UTSW 10 81178768 frame shift probably null
R6650:Eef2 UTSW 10 81178768 frame shift probably null
R7326:Eef2 UTSW 10 81181282 missense probably benign 0.26
R7472:Eef2 UTSW 10 81179550 missense probably benign 0.01
R7579:Eef2 UTSW 10 81178768 frame shift probably null
R8013:Eef2 UTSW 10 81178196 missense probably damaging 1.00
R8143:Eef2 UTSW 10 81181348 missense probably damaging 1.00
Z1088:Eef2 UTSW 10 81181889 missense probably damaging 1.00
Z1176:Eef2 UTSW 10 81181158 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTTGTGTACATTTCACAGAC -3'
(R):5'- TTCCGTCATCATGGTGGGTC -3'

Sequencing Primer
(F):5'- AAAACATACGTGGTCTTCAGGC -3'
(R):5'- CATCATGGTGGGTCAGAGATTCCC -3'
Posted On2015-07-21