Incidental Mutation 'R4433:Olfr384'
ID328713
Institutional Source Beutler Lab
Gene Symbol Olfr384
Ensembl Gene ENSMUSG00000060335
Gene Nameolfactory receptor 384
SynonymsOlfr386, GA_x6K02T2P1NL-3739520-3740032, GA_x6K02T2P1NL-3773152-3774090, MOR135-5
MMRRC Submission 041147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4433 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73598594-73605092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73602886 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 102 (Y102C)
Ref Sequence ENSEMBL: ENSMUSP00000148997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072993] [ENSMUST00000214228]
Predicted Effect probably damaging
Transcript: ENSMUST00000072993
AA Change: Y102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072758
Gene: ENSMUSG00000060335
AA Change: Y102C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.6e-9 PFAM
Pfam:7tm_1 41 290 1.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214228
AA Change: Y102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4347 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,368,187 probably null Het
Acsm2 A G 7: 119,554,509 H14R unknown Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ak5 A G 3: 152,655,880 I135T probably damaging Het
Alk G T 17: 71,899,241 S1038* probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Ap2m1 A T 16: 20,543,384 H414L possibly damaging Het
Atp13a5 A T 16: 29,282,024 M649K probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc25b A G 2: 131,191,698 S186G probably benign Het
Ceacam16 A G 7: 19,853,589 V418A possibly damaging Het
Cntnap3 A C 13: 64,778,853 S568A possibly damaging Het
Col24a1 G T 3: 145,314,383 V172F possibly damaging Het
E430018J23Rik T G 7: 127,393,002 Q87P possibly damaging Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Esp36 T A 17: 38,418,956 T15S unknown Het
Fam126a A C 5: 23,979,581 C218G possibly damaging Het
Fam26f T A 10: 34,127,831 T27S probably damaging Het
Fat2 A T 11: 55,309,640 H869Q possibly damaging Het
Fat3 A G 9: 16,031,152 V1308A probably damaging Het
Gimap3 T C 6: 48,765,946 T17A possibly damaging Het
Hnrnpr A G 4: 136,317,148 K13R probably benign Het
Kdr A G 5: 75,943,925 M1133T possibly damaging Het
Mgarp A G 3: 51,396,260 probably benign Het
Neto2 G A 8: 85,641,083 T337I probably damaging Het
Nfib C T 4: 82,498,435 R137Q probably damaging Het
Nr3c2 A G 8: 77,217,467 E890G probably damaging Het
Nsun4 A G 4: 116,040,130 V228A possibly damaging Het
Nt5c1a T A 4: 123,215,896 S263T probably benign Het
Ntm A T 9: 29,012,220 Y45* probably null Het
Nts A G 10: 102,485,027 V67A probably benign Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Olfr378 A T 11: 73,425,711 S91T possibly damaging Het
Olfr610 T A 7: 103,506,139 K269M probably benign Het
Ostm1 C A 10: 42,679,123 A47E probably benign Het
Otol1 G A 3: 70,018,548 V19M probably benign Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcdhgb1 T C 18: 37,681,251 I265T probably damaging Het
Pdzd3 T C 9: 44,247,988 *499W probably null Het
Pex14 T C 4: 148,961,510 E321G possibly damaging Het
Phactr3 C A 2: 178,283,132 R251S probably damaging Het
Pkdcc C T 17: 83,221,141 T313M probably benign Het
Plce1 A T 19: 38,767,301 E1911V probably damaging Het
Ptprv G T 1: 135,114,570 noncoding transcript Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rhob A G 12: 8,499,533 Y34H possibly damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc9c1 A T 16: 45,599,466 I1000F possibly damaging Het
Tcf7 G T 11: 52,261,615 P36T probably benign Het
Tcf7l1 C G 6: 72,788,769 E62Q probably damaging Het
Tctex1d4 C T 4: 117,128,123 R48C probably damaging Het
Tll2 A G 19: 41,121,348 S326P probably benign Het
Tubgcp4 A G 2: 121,184,473 N288S probably benign Het
Zfhx3 G A 8: 108,955,637 R3236H unknown Het
Zgrf1 A G 3: 127,562,078 T318A probably benign Het
Other mutations in Olfr384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr384 APN 11 73603230 missense probably damaging 1.00
IGL01767:Olfr384 APN 11 73603032 missense probably benign
IGL02296:Olfr384 APN 11 73602706 missense probably damaging 1.00
IGL02327:Olfr384 APN 11 73603155 missense probably damaging 1.00
IGL02740:Olfr384 APN 11 73602831 missense probably benign 0.41
H8562:Olfr384 UTSW 11 73603447 missense probably damaging 1.00
R0594:Olfr384 UTSW 11 73603392 missense probably benign 0.03
R2038:Olfr384 UTSW 11 73603413 missense probably damaging 1.00
R2127:Olfr384 UTSW 11 73602805 missense possibly damaging 0.78
R2844:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R2846:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R3877:Olfr384 UTSW 11 73603153 missense probably damaging 1.00
R4193:Olfr384 UTSW 11 73603417 missense probably damaging 1.00
R4824:Olfr384 UTSW 11 73602600 missense possibly damaging 0.61
R4851:Olfr384 UTSW 11 73603057 missense probably damaging 1.00
R5285:Olfr384 UTSW 11 73602941 nonsense probably null
R5326:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5542:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5662:Olfr384 UTSW 11 73603179 missense probably benign 0.03
R6489:Olfr384 UTSW 11 73603439 missense probably damaging 1.00
R6770:Olfr384 UTSW 11 73602978 missense probably benign 0.04
R7131:Olfr384 UTSW 11 73602736 missense possibly damaging 0.78
R7313:Olfr384 UTSW 11 73602984 missense probably damaging 0.99
R7754:Olfr384 UTSW 11 73603506 nonsense probably null
R8393:Olfr384 UTSW 11 73603435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTACCTCACCACTGTCCTGG -3'
(R):5'- GACAATCTTGCCAAGAGTAGGG -3'

Sequencing Primer
(F):5'- TCACCACTGTCCTGGGGAAC -3'
(R):5'- ATCTTGCCAAGAGTAGGGTGTGTAAC -3'
Posted On2015-07-21