Mutagenetix > Incidental Mutation

Incidental Mutation 'R4433:Cntnap3'

328715

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

041147-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R4433 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 64778853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 568 (S568A)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091554
AA Change: S568A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: S568A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.1568

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	T	16: 20,368,187		probably null	Het
Acsm2	A	G	7: 119,554,509	H14R	unknown	Het
Adamtsl4	T	C	3: 95,681,759		probably null	Het
Ak5	A	G	3: 152,655,880	I135T	probably damaging	Het
Alk	G	T	17: 71,899,241	S1038*	probably null	Het
Ank2	A	T	3: 126,947,806		probably benign	Het
Ap2m1	A	T	16: 20,543,384	H414L	possibly damaging	Het
Atp13a5	A	T	16: 29,282,024	M649K	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Cdc25b	A	G	2: 131,191,698	S186G	probably benign	Het
Ceacam16	A	G	7: 19,853,589	V418A	possibly damaging	Het
Col24a1	G	T	3: 145,314,383	V172F	possibly damaging	Het
E430018J23Rik	T	G	7: 127,393,002	Q87P	possibly damaging	Het
Eef2	CCC	CCCC	10: 81,178,768		probably null	Het
Esp36	T	A	17: 38,418,956	T15S	unknown	Het
Fam126a	A	C	5: 23,979,581	C218G	possibly damaging	Het
Fam26f	T	A	10: 34,127,831	T27S	probably damaging	Het
Fat2	A	T	11: 55,309,640	H869Q	possibly damaging	Het
Fat3	A	G	9: 16,031,152	V1308A	probably damaging	Het
Gimap3	T	C	6: 48,765,946	T17A	possibly damaging	Het
Hnrnpr	A	G	4: 136,317,148	K13R	probably benign	Het
Kdr	A	G	5: 75,943,925	M1133T	possibly damaging	Het
Mgarp	A	G	3: 51,396,260		probably benign	Het
Neto2	G	A	8: 85,641,083	T337I	probably damaging	Het
Nfib	C	T	4: 82,498,435	R137Q	probably damaging	Het
Nr3c2	A	G	8: 77,217,467	E890G	probably damaging	Het
Nsun4	A	G	4: 116,040,130	V228A	possibly damaging	Het
Nt5c1a	T	A	4: 123,215,896	S263T	probably benign	Het
Ntm	A	T	9: 29,012,220	Y45*	probably null	Het
Nts	A	G	10: 102,485,027	V67A	probably benign	Het
Olfr1288	T	A	2: 111,479,412	C209*	probably null	Het
Olfr378	A	T	11: 73,425,711	S91T	possibly damaging	Het
Olfr384	A	G	11: 73,602,886	Y102C	probably damaging	Het
Olfr610	T	A	7: 103,506,139	K269M	probably benign	Het
Ostm1	C	A	10: 42,679,123	A47E	probably benign	Het
Otol1	G	A	3: 70,018,548	V19M	probably benign	Het
Pcdhb15	A	G	18: 37,475,512	N599S	probably damaging	Het
Pcdhgb1	T	C	18: 37,681,251	I265T	probably damaging	Het
Pdzd3	T	C	9: 44,247,988	*499W	probably null	Het
Pex14	T	C	4: 148,961,510	E321G	possibly damaging	Het
Phactr3	C	A	2: 178,283,132	R251S	probably damaging	Het
Pkdcc	C	T	17: 83,221,141	T313M	probably benign	Het
Plce1	A	T	19: 38,767,301	E1911V	probably damaging	Het
Ptprv	G	T	1: 135,114,570		noncoding transcript	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rhob	A	G	12: 8,499,533	Y34H	possibly damaging	Het
Slc27a3	G	A	3: 90,387,340	T408M	probably damaging	Het
Slc9c1	A	T	16: 45,599,466	I1000F	possibly damaging	Het
Tcf7	G	T	11: 52,261,615	P36T	probably benign	Het
Tcf7l1	C	G	6: 72,788,769	E62Q	probably damaging	Het
Tctex1d4	C	T	4: 117,128,123	R48C	probably damaging	Het
Tll2	A	G	19: 41,121,348	S326P	probably benign	Het
Tubgcp4	A	G	2: 121,184,473	N288S	probably benign	Het
Zfhx3	G	A	8: 108,955,637	R3236H	unknown	Het
Zgrf1	A	G	3: 127,562,078	T318A	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTGCATGGTTGACAATATGCAG -3'
(R):5'- GTTCACTGGTCATGCTGAATTTTC -3'

Sequencing Primer
(F):5'- GCATGGTTGACAATATGCAGATAAAC -3'
(R):5'- CTTGCATACACCGCTGTT -3'

Posted On

2015-07-21