Incidental Mutation 'R4433:Cntnap3'
ID 328715
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 041147-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R4433 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 64926667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 568 (S568A)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect possibly damaging
Transcript: ENSMUST00000091554
AA Change: S568A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: S568A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Meta Mutation Damage Score 0.1568 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,186,937 (GRCm39) probably null Het
Acsm2 A G 7: 119,153,732 (GRCm39) H14R unknown Het
Adamtsl4 T C 3: 95,589,069 (GRCm39) probably null Het
Ak5 A G 3: 152,361,517 (GRCm39) I135T probably damaging Het
Alk G T 17: 72,206,236 (GRCm39) S1038* probably null Het
Ank2 A T 3: 126,741,455 (GRCm39) probably benign Het
Ap2m1 A T 16: 20,362,134 (GRCm39) H414L possibly damaging Het
Atp13a5 A T 16: 29,100,842 (GRCm39) M649K probably damaging Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Calhm6 T A 10: 34,003,827 (GRCm39) T27S probably damaging Het
Cdc25b A G 2: 131,033,618 (GRCm39) S186G probably benign Het
Ceacam16 A G 7: 19,587,514 (GRCm39) V418A possibly damaging Het
Col24a1 G T 3: 145,020,144 (GRCm39) V172F possibly damaging Het
Dynlt4 C T 4: 116,985,320 (GRCm39) R48C probably damaging Het
Eef2 CCC CCCC 10: 81,014,602 (GRCm39) probably null Het
Esp36 T A 17: 38,729,847 (GRCm39) T15S unknown Het
Fat2 A T 11: 55,200,466 (GRCm39) H869Q possibly damaging Het
Fat3 A G 9: 15,942,448 (GRCm39) V1308A probably damaging Het
Gimap3 T C 6: 48,742,880 (GRCm39) T17A possibly damaging Het
Hnrnpr A G 4: 136,044,459 (GRCm39) K13R probably benign Het
Hycc1 A C 5: 24,184,579 (GRCm39) C218G possibly damaging Het
Kdr A G 5: 76,104,585 (GRCm39) M1133T possibly damaging Het
Mgarp A G 3: 51,303,681 (GRCm39) probably benign Het
Neto2 G A 8: 86,367,712 (GRCm39) T337I probably damaging Het
Nfib C T 4: 82,416,672 (GRCm39) R137Q probably damaging Het
Nherf4 T C 9: 44,159,285 (GRCm39) *499W probably null Het
Nr3c2 A G 8: 77,944,096 (GRCm39) E890G probably damaging Het
Nsun4 A G 4: 115,897,327 (GRCm39) V228A possibly damaging Het
Nt5c1a T A 4: 123,109,689 (GRCm39) S263T probably benign Het
Ntm A T 9: 28,923,516 (GRCm39) Y45* probably null Het
Nts A G 10: 102,320,888 (GRCm39) V67A probably benign Het
Or1e19 A T 11: 73,316,537 (GRCm39) S91T possibly damaging Het
Or1e25 A G 11: 73,493,712 (GRCm39) Y102C probably damaging Het
Or4g7 T A 2: 111,309,757 (GRCm39) C209* probably null Het
Or51ag1 T A 7: 103,155,346 (GRCm39) K269M probably benign Het
Ostm1 C A 10: 42,555,119 (GRCm39) A47E probably benign Het
Otol1 G A 3: 69,925,881 (GRCm39) V19M probably benign Het
Pcdhb15 A G 18: 37,608,565 (GRCm39) N599S probably damaging Het
Pcdhgb1 T C 18: 37,814,304 (GRCm39) I265T probably damaging Het
Pex14 T C 4: 149,045,967 (GRCm39) E321G possibly damaging Het
Phactr3 C A 2: 177,924,925 (GRCm39) R251S probably damaging Het
Pkdcc C T 17: 83,528,570 (GRCm39) T313M probably benign Het
Plce1 A T 19: 38,755,745 (GRCm39) E1911V probably damaging Het
Ptprv G T 1: 135,042,308 (GRCm39) noncoding transcript Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rhob A G 12: 8,549,533 (GRCm39) Y34H possibly damaging Het
Slc27a3 G A 3: 90,294,647 (GRCm39) T408M probably damaging Het
Slc9c1 A T 16: 45,419,829 (GRCm39) I1000F possibly damaging Het
Tcf7 G T 11: 52,152,442 (GRCm39) P36T probably benign Het
Tcf7l1 C G 6: 72,765,752 (GRCm39) E62Q probably damaging Het
Tll2 A G 19: 41,109,787 (GRCm39) S326P probably benign Het
Tubgcp4 A G 2: 121,014,954 (GRCm39) N288S probably benign Het
Zfhx3 G A 8: 109,682,269 (GRCm39) R3236H unknown Het
Zfp764l1 T G 7: 126,992,174 (GRCm39) Q87P possibly damaging Het
Zgrf1 A G 3: 127,355,727 (GRCm39) T318A probably benign Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCATGGTTGACAATATGCAG -3'
(R):5'- GTTCACTGGTCATGCTGAATTTTC -3'

Sequencing Primer
(F):5'- GCATGGTTGACAATATGCAGATAAAC -3'
(R):5'- CTTGCATACACCGCTGTT -3'
Posted On 2015-07-21