Incidental Mutation 'R4433:Slc9c1'
ID 328719
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 041147-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R4433 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45419829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1000 (I1000F)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: I1000F

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I1000F

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,186,937 (GRCm39) probably null Het
Acsm2 A G 7: 119,153,732 (GRCm39) H14R unknown Het
Adamtsl4 T C 3: 95,589,069 (GRCm39) probably null Het
Ak5 A G 3: 152,361,517 (GRCm39) I135T probably damaging Het
Alk G T 17: 72,206,236 (GRCm39) S1038* probably null Het
Ank2 A T 3: 126,741,455 (GRCm39) probably benign Het
Ap2m1 A T 16: 20,362,134 (GRCm39) H414L possibly damaging Het
Atp13a5 A T 16: 29,100,842 (GRCm39) M649K probably damaging Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Calhm6 T A 10: 34,003,827 (GRCm39) T27S probably damaging Het
Cdc25b A G 2: 131,033,618 (GRCm39) S186G probably benign Het
Ceacam16 A G 7: 19,587,514 (GRCm39) V418A possibly damaging Het
Cntnap3 A C 13: 64,926,667 (GRCm39) S568A possibly damaging Het
Col24a1 G T 3: 145,020,144 (GRCm39) V172F possibly damaging Het
Dynlt4 C T 4: 116,985,320 (GRCm39) R48C probably damaging Het
Eef2 CCC CCCC 10: 81,014,602 (GRCm39) probably null Het
Esp36 T A 17: 38,729,847 (GRCm39) T15S unknown Het
Fat2 A T 11: 55,200,466 (GRCm39) H869Q possibly damaging Het
Fat3 A G 9: 15,942,448 (GRCm39) V1308A probably damaging Het
Gimap3 T C 6: 48,742,880 (GRCm39) T17A possibly damaging Het
Hnrnpr A G 4: 136,044,459 (GRCm39) K13R probably benign Het
Hycc1 A C 5: 24,184,579 (GRCm39) C218G possibly damaging Het
Kdr A G 5: 76,104,585 (GRCm39) M1133T possibly damaging Het
Mgarp A G 3: 51,303,681 (GRCm39) probably benign Het
Neto2 G A 8: 86,367,712 (GRCm39) T337I probably damaging Het
Nfib C T 4: 82,416,672 (GRCm39) R137Q probably damaging Het
Nherf4 T C 9: 44,159,285 (GRCm39) *499W probably null Het
Nr3c2 A G 8: 77,944,096 (GRCm39) E890G probably damaging Het
Nsun4 A G 4: 115,897,327 (GRCm39) V228A possibly damaging Het
Nt5c1a T A 4: 123,109,689 (GRCm39) S263T probably benign Het
Ntm A T 9: 28,923,516 (GRCm39) Y45* probably null Het
Nts A G 10: 102,320,888 (GRCm39) V67A probably benign Het
Or1e19 A T 11: 73,316,537 (GRCm39) S91T possibly damaging Het
Or1e25 A G 11: 73,493,712 (GRCm39) Y102C probably damaging Het
Or4g7 T A 2: 111,309,757 (GRCm39) C209* probably null Het
Or51ag1 T A 7: 103,155,346 (GRCm39) K269M probably benign Het
Ostm1 C A 10: 42,555,119 (GRCm39) A47E probably benign Het
Otol1 G A 3: 69,925,881 (GRCm39) V19M probably benign Het
Pcdhb15 A G 18: 37,608,565 (GRCm39) N599S probably damaging Het
Pcdhgb1 T C 18: 37,814,304 (GRCm39) I265T probably damaging Het
Pex14 T C 4: 149,045,967 (GRCm39) E321G possibly damaging Het
Phactr3 C A 2: 177,924,925 (GRCm39) R251S probably damaging Het
Pkdcc C T 17: 83,528,570 (GRCm39) T313M probably benign Het
Plce1 A T 19: 38,755,745 (GRCm39) E1911V probably damaging Het
Ptprv G T 1: 135,042,308 (GRCm39) noncoding transcript Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rhob A G 12: 8,549,533 (GRCm39) Y34H possibly damaging Het
Slc27a3 G A 3: 90,294,647 (GRCm39) T408M probably damaging Het
Tcf7 G T 11: 52,152,442 (GRCm39) P36T probably benign Het
Tcf7l1 C G 6: 72,765,752 (GRCm39) E62Q probably damaging Het
Tll2 A G 19: 41,109,787 (GRCm39) S326P probably benign Het
Tubgcp4 A G 2: 121,014,954 (GRCm39) N288S probably benign Het
Zfhx3 G A 8: 109,682,269 (GRCm39) R3236H unknown Het
Zfp764l1 T G 7: 126,992,174 (GRCm39) Q87P possibly damaging Het
Zgrf1 A G 3: 127,355,727 (GRCm39) T318A probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTGTTCAAGATTGCAAGCCTG -3'
(R):5'- CACAGGCTCATGACACTAGC -3'

Sequencing Primer
(F):5'- GCCTGAGCTAATAAATGCATTTTATG -3'
(R):5'- GGCTCATGACACTAGCTTACAGTC -3'
Posted On 2015-07-21