Incidental Mutation 'R4433:Slc9c1'
ID328719
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission 041147-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R4433 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45599466 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1000 (I1000F)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: I1000F

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I1000F

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,368,187 probably null Het
Acsm2 A G 7: 119,554,509 H14R unknown Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ak5 A G 3: 152,655,880 I135T probably damaging Het
Alk G T 17: 71,899,241 S1038* probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Ap2m1 A T 16: 20,543,384 H414L possibly damaging Het
Atp13a5 A T 16: 29,282,024 M649K probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc25b A G 2: 131,191,698 S186G probably benign Het
Ceacam16 A G 7: 19,853,589 V418A possibly damaging Het
Cntnap3 A C 13: 64,778,853 S568A possibly damaging Het
Col24a1 G T 3: 145,314,383 V172F possibly damaging Het
E430018J23Rik T G 7: 127,393,002 Q87P possibly damaging Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Esp36 T A 17: 38,418,956 T15S unknown Het
Fam126a A C 5: 23,979,581 C218G possibly damaging Het
Fam26f T A 10: 34,127,831 T27S probably damaging Het
Fat2 A T 11: 55,309,640 H869Q possibly damaging Het
Fat3 A G 9: 16,031,152 V1308A probably damaging Het
Gimap3 T C 6: 48,765,946 T17A possibly damaging Het
Hnrnpr A G 4: 136,317,148 K13R probably benign Het
Kdr A G 5: 75,943,925 M1133T possibly damaging Het
Mgarp A G 3: 51,396,260 probably benign Het
Neto2 G A 8: 85,641,083 T337I probably damaging Het
Nfib C T 4: 82,498,435 R137Q probably damaging Het
Nr3c2 A G 8: 77,217,467 E890G probably damaging Het
Nsun4 A G 4: 116,040,130 V228A possibly damaging Het
Nt5c1a T A 4: 123,215,896 S263T probably benign Het
Ntm A T 9: 29,012,220 Y45* probably null Het
Nts A G 10: 102,485,027 V67A probably benign Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Olfr378 A T 11: 73,425,711 S91T possibly damaging Het
Olfr384 A G 11: 73,602,886 Y102C probably damaging Het
Olfr610 T A 7: 103,506,139 K269M probably benign Het
Ostm1 C A 10: 42,679,123 A47E probably benign Het
Otol1 G A 3: 70,018,548 V19M probably benign Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcdhgb1 T C 18: 37,681,251 I265T probably damaging Het
Pdzd3 T C 9: 44,247,988 *499W probably null Het
Pex14 T C 4: 148,961,510 E321G possibly damaging Het
Phactr3 C A 2: 178,283,132 R251S probably damaging Het
Pkdcc C T 17: 83,221,141 T313M probably benign Het
Plce1 A T 19: 38,767,301 E1911V probably damaging Het
Ptprv G T 1: 135,114,570 noncoding transcript Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rhob A G 12: 8,499,533 Y34H possibly damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Tcf7 G T 11: 52,261,615 P36T probably benign Het
Tcf7l1 C G 6: 72,788,769 E62Q probably damaging Het
Tctex1d4 C T 4: 117,128,123 R48C probably damaging Het
Tll2 A G 19: 41,121,348 S326P probably benign Het
Tubgcp4 A G 2: 121,184,473 N288S probably benign Het
Zfhx3 G A 8: 108,955,637 R3236H unknown Het
Zgrf1 A G 3: 127,562,078 T318A probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCTGTTCAAGATTGCAAGCCTG -3'
(R):5'- CACAGGCTCATGACACTAGC -3'

Sequencing Primer
(F):5'- GCCTGAGCTAATAAATGCATTTTATG -3'
(R):5'- GGCTCATGACACTAGCTTACAGTC -3'
Posted On2015-07-21