Incidental Mutation 'R4433:Pcdhb15'
ID 328724
Institutional Source Beutler Lab
Gene Symbol Pcdhb15
Ensembl Gene ENSMUSG00000047033
Gene Name protocadherin beta 15
Synonyms Pcdhb7, PcdhbO
MMRRC Submission 041147-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R4433 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 37606599-37609393 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37608565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 599 (N599S)
Ref Sequence ENSEMBL: ENSMUSP00000059598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91Y04
Predicted Effect probably damaging
Transcript: ENSMUST00000050034
AA Change: N599S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033
AA Change: N599S

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.2115 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,186,937 (GRCm39) probably null Het
Acsm2 A G 7: 119,153,732 (GRCm39) H14R unknown Het
Adamtsl4 T C 3: 95,589,069 (GRCm39) probably null Het
Ak5 A G 3: 152,361,517 (GRCm39) I135T probably damaging Het
Alk G T 17: 72,206,236 (GRCm39) S1038* probably null Het
Ank2 A T 3: 126,741,455 (GRCm39) probably benign Het
Ap2m1 A T 16: 20,362,134 (GRCm39) H414L possibly damaging Het
Atp13a5 A T 16: 29,100,842 (GRCm39) M649K probably damaging Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Calhm6 T A 10: 34,003,827 (GRCm39) T27S probably damaging Het
Cdc25b A G 2: 131,033,618 (GRCm39) S186G probably benign Het
Ceacam16 A G 7: 19,587,514 (GRCm39) V418A possibly damaging Het
Cntnap3 A C 13: 64,926,667 (GRCm39) S568A possibly damaging Het
Col24a1 G T 3: 145,020,144 (GRCm39) V172F possibly damaging Het
Dynlt4 C T 4: 116,985,320 (GRCm39) R48C probably damaging Het
Eef2 CCC CCCC 10: 81,014,602 (GRCm39) probably null Het
Esp36 T A 17: 38,729,847 (GRCm39) T15S unknown Het
Fat2 A T 11: 55,200,466 (GRCm39) H869Q possibly damaging Het
Fat3 A G 9: 15,942,448 (GRCm39) V1308A probably damaging Het
Gimap3 T C 6: 48,742,880 (GRCm39) T17A possibly damaging Het
Hnrnpr A G 4: 136,044,459 (GRCm39) K13R probably benign Het
Hycc1 A C 5: 24,184,579 (GRCm39) C218G possibly damaging Het
Kdr A G 5: 76,104,585 (GRCm39) M1133T possibly damaging Het
Mgarp A G 3: 51,303,681 (GRCm39) probably benign Het
Neto2 G A 8: 86,367,712 (GRCm39) T337I probably damaging Het
Nfib C T 4: 82,416,672 (GRCm39) R137Q probably damaging Het
Nherf4 T C 9: 44,159,285 (GRCm39) *499W probably null Het
Nr3c2 A G 8: 77,944,096 (GRCm39) E890G probably damaging Het
Nsun4 A G 4: 115,897,327 (GRCm39) V228A possibly damaging Het
Nt5c1a T A 4: 123,109,689 (GRCm39) S263T probably benign Het
Ntm A T 9: 28,923,516 (GRCm39) Y45* probably null Het
Nts A G 10: 102,320,888 (GRCm39) V67A probably benign Het
Or1e19 A T 11: 73,316,537 (GRCm39) S91T possibly damaging Het
Or1e25 A G 11: 73,493,712 (GRCm39) Y102C probably damaging Het
Or4g7 T A 2: 111,309,757 (GRCm39) C209* probably null Het
Or51ag1 T A 7: 103,155,346 (GRCm39) K269M probably benign Het
Ostm1 C A 10: 42,555,119 (GRCm39) A47E probably benign Het
Otol1 G A 3: 69,925,881 (GRCm39) V19M probably benign Het
Pcdhgb1 T C 18: 37,814,304 (GRCm39) I265T probably damaging Het
Pex14 T C 4: 149,045,967 (GRCm39) E321G possibly damaging Het
Phactr3 C A 2: 177,924,925 (GRCm39) R251S probably damaging Het
Pkdcc C T 17: 83,528,570 (GRCm39) T313M probably benign Het
Plce1 A T 19: 38,755,745 (GRCm39) E1911V probably damaging Het
Ptprv G T 1: 135,042,308 (GRCm39) noncoding transcript Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rhob A G 12: 8,549,533 (GRCm39) Y34H possibly damaging Het
Slc27a3 G A 3: 90,294,647 (GRCm39) T408M probably damaging Het
Slc9c1 A T 16: 45,419,829 (GRCm39) I1000F possibly damaging Het
Tcf7 G T 11: 52,152,442 (GRCm39) P36T probably benign Het
Tcf7l1 C G 6: 72,765,752 (GRCm39) E62Q probably damaging Het
Tll2 A G 19: 41,109,787 (GRCm39) S326P probably benign Het
Tubgcp4 A G 2: 121,014,954 (GRCm39) N288S probably benign Het
Zfhx3 G A 8: 109,682,269 (GRCm39) R3236H unknown Het
Zfp764l1 T G 7: 126,992,174 (GRCm39) Q87P possibly damaging Het
Zgrf1 A G 3: 127,355,727 (GRCm39) T318A probably benign Het
Other mutations in Pcdhb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Pcdhb15 APN 18 37,608,207 (GRCm39) missense probably damaging 1.00
IGL01536:Pcdhb15 APN 18 37,608,046 (GRCm39) missense probably benign 0.01
IGL01664:Pcdhb15 APN 18 37,607,314 (GRCm39) missense probably benign 0.35
IGL02001:Pcdhb15 APN 18 37,607,091 (GRCm39) missense probably benign 0.01
IGL02161:Pcdhb15 APN 18 37,608,555 (GRCm39) missense possibly damaging 0.78
IGL02205:Pcdhb15 APN 18 37,607,010 (GRCm39) missense probably damaging 0.99
IGL02748:Pcdhb15 APN 18 37,608,273 (GRCm39) missense probably damaging 0.98
IGL02828:Pcdhb15 APN 18 37,606,903 (GRCm39) missense probably damaging 0.97
IGL02974:Pcdhb15 APN 18 37,608,067 (GRCm39) missense probably damaging 1.00
IGL03119:Pcdhb15 APN 18 37,608,067 (GRCm39) missense probably damaging 1.00
IGL03136:Pcdhb15 APN 18 37,608,067 (GRCm39) missense probably damaging 1.00
IGL03150:Pcdhb15 APN 18 37,608,067 (GRCm39) missense probably damaging 1.00
PIT1430001:Pcdhb15 UTSW 18 37,608,724 (GRCm39) missense probably benign 0.15
R0266:Pcdhb15 UTSW 18 37,608,329 (GRCm39) missense probably damaging 1.00
R0288:Pcdhb15 UTSW 18 37,608,451 (GRCm39) missense probably damaging 1.00
R0399:Pcdhb15 UTSW 18 37,607,221 (GRCm39) missense possibly damaging 0.56
R0400:Pcdhb15 UTSW 18 37,608,948 (GRCm39) missense probably benign
R0554:Pcdhb15 UTSW 18 37,607,572 (GRCm39) missense probably damaging 1.00
R0637:Pcdhb15 UTSW 18 37,608,619 (GRCm39) missense probably damaging 1.00
R0714:Pcdhb15 UTSW 18 37,607,674 (GRCm39) missense probably damaging 0.98
R1118:Pcdhb15 UTSW 18 37,606,815 (GRCm39) missense probably benign 0.01
R1423:Pcdhb15 UTSW 18 37,606,975 (GRCm39) missense probably damaging 0.97
R1672:Pcdhb15 UTSW 18 37,607,713 (GRCm39) missense probably damaging 1.00
R1681:Pcdhb15 UTSW 18 37,606,866 (GRCm39) missense probably damaging 1.00
R1779:Pcdhb15 UTSW 18 37,609,084 (GRCm39) missense possibly damaging 0.95
R2206:Pcdhb15 UTSW 18 37,608,075 (GRCm39) missense probably benign 0.05
R2207:Pcdhb15 UTSW 18 37,608,075 (GRCm39) missense probably benign 0.05
R2274:Pcdhb15 UTSW 18 37,608,496 (GRCm39) missense probably damaging 1.00
R3406:Pcdhb15 UTSW 18 37,608,442 (GRCm39) missense probably benign 0.41
R3407:Pcdhb15 UTSW 18 37,607,442 (GRCm39) missense possibly damaging 0.80
R3417:Pcdhb15 UTSW 18 37,608,216 (GRCm39) missense probably damaging 1.00
R3752:Pcdhb15 UTSW 18 37,606,810 (GRCm39) missense probably damaging 1.00
R3773:Pcdhb15 UTSW 18 37,608,943 (GRCm39) missense probably benign 0.00
R4432:Pcdhb15 UTSW 18 37,608,565 (GRCm39) missense probably damaging 1.00
R4583:Pcdhb15 UTSW 18 37,608,628 (GRCm39) missense possibly damaging 0.91
R4612:Pcdhb15 UTSW 18 37,608,648 (GRCm39) missense probably damaging 0.96
R4988:Pcdhb15 UTSW 18 37,608,855 (GRCm39) missense probably damaging 0.98
R5635:Pcdhb15 UTSW 18 37,606,823 (GRCm39) nonsense probably null
R5692:Pcdhb15 UTSW 18 37,607,502 (GRCm39) missense probably benign 0.01
R5742:Pcdhb15 UTSW 18 37,607,820 (GRCm39) missense probably damaging 0.99
R5913:Pcdhb15 UTSW 18 37,607,707 (GRCm39) missense probably benign 0.07
R6350:Pcdhb15 UTSW 18 37,608,414 (GRCm39) missense probably damaging 1.00
R6522:Pcdhb15 UTSW 18 37,607,314 (GRCm39) missense probably benign 0.35
R6676:Pcdhb15 UTSW 18 37,607,860 (GRCm39) missense possibly damaging 0.60
R6693:Pcdhb15 UTSW 18 37,607,394 (GRCm39) missense probably benign 0.01
R6905:Pcdhb15 UTSW 18 37,607,748 (GRCm39) missense possibly damaging 0.95
R7029:Pcdhb15 UTSW 18 37,608,621 (GRCm39) missense possibly damaging 0.85
R7335:Pcdhb15 UTSW 18 37,607,389 (GRCm39) missense probably damaging 1.00
R7529:Pcdhb15 UTSW 18 37,607,526 (GRCm39) nonsense probably null
R7718:Pcdhb15 UTSW 18 37,608,216 (GRCm39) missense probably damaging 1.00
R7782:Pcdhb15 UTSW 18 37,607,788 (GRCm39) missense possibly damaging 0.88
R7967:Pcdhb15 UTSW 18 37,607,902 (GRCm39) missense probably damaging 1.00
R8170:Pcdhb15 UTSW 18 37,608,637 (GRCm39) missense probably damaging 1.00
R8323:Pcdhb15 UTSW 18 37,608,715 (GRCm39) missense probably benign 0.18
R8725:Pcdhb15 UTSW 18 37,608,734 (GRCm39) missense probably damaging 0.99
R8820:Pcdhb15 UTSW 18 37,606,971 (GRCm39) missense probably benign 0.03
R9117:Pcdhb15 UTSW 18 37,608,090 (GRCm39) missense probably damaging 1.00
R9280:Pcdhb15 UTSW 18 37,607,794 (GRCm39) missense probably damaging 1.00
R9367:Pcdhb15 UTSW 18 37,607,971 (GRCm39) missense possibly damaging 0.95
R9424:Pcdhb15 UTSW 18 37,607,263 (GRCm39) missense
R9432:Pcdhb15 UTSW 18 37,608,683 (GRCm39) missense probably benign 0.04
R9498:Pcdhb15 UTSW 18 37,606,890 (GRCm39) nonsense probably null
R9544:Pcdhb15 UTSW 18 37,608,948 (GRCm39) missense probably benign
X0062:Pcdhb15 UTSW 18 37,609,068 (GRCm39) nonsense probably null
X0063:Pcdhb15 UTSW 18 37,608,137 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGTGCAATAGACCAAGGC -3'
(R):5'- TGAGAGAAGCCATCGACCAG -3'

Sequencing Primer
(F):5'- TAGACCAAGGCTCCCCTG -3'
(R):5'- GCCATCGACCAGCAACACATG -3'
Posted On 2015-07-21