Mutagenetix > Incidental Mutation

Incidental Mutation 'R0044:Agbl3'

32875

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

038338-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0044 (G1)

Quality Score

204

Status

Validated (trace)

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34799899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 447 (M447L)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: M447L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: M447L

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: M442L

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: M442L

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143474

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Meta Mutation Damage Score

0.1135

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

100% (77/77)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430571L13Rik	A	C	9: 107,342,499	R50S	probably damaging	Het
Actn2	G	T	13: 12,275,127	T176N	possibly damaging	Het
Adamts7	T	C	9: 90,171,588	V62A	possibly damaging	Het
Adcy2	A	G	13: 68,727,899	S495P	possibly damaging	Het
Asxl1	C	T	2: 153,400,209	T893I	probably benign	Het
Atp11b	T	A	3: 35,812,252	I400N	probably damaging	Het
Bpifb2	C	T	2: 153,882,679		probably benign	Het
Capn1	T	A	19: 6,014,343	Y42F	probably benign	Het
Cdk5rap2	A	T	4: 70,360,901	L190H	probably damaging	Het
Cfap54	T	C	10: 93,035,433	I594V	probably null	Het
Cpsf1	A	G	15: 76,599,553	V830A	probably benign	Het
Cyp2c70	T	A	19: 40,165,371	N258I	possibly damaging	Het
Dctn1	T	G	6: 83,191,134	Y386D	probably damaging	Het
Degs2	T	C	12: 108,692,154	N189D	probably damaging	Het
Dido1	C	T	2: 180,661,819	A1431T	probably damaging	Het
Diras1	G	T	10: 81,022,138	S93*	probably null	Het
E130308A19Rik	T	A	4: 59,690,290	H41Q	possibly damaging	Het
Ebf2	C	T	14: 67,310,968		probably benign	Het
Fcho2	A	G	13: 98,755,544		probably benign	Het
Gbe1	T	A	16: 70,561,132	Y681*	probably null	Het
Gm10036	A	C	18: 15,832,816	K8T	probably benign	Het
Herc1	T	A	9: 66,448,175	M2236K	probably benign	Het
Hmcn2	A	T	2: 31,412,508	Y2948F	probably damaging	Het
Jakmip2	A	T	18: 43,582,105	C119S	probably benign	Het
Kif1b	A	G	4: 149,263,601		probably benign	Het
Kif6	T	C	17: 49,832,256		probably benign	Het
Lpin1	A	T	12: 16,568,529		probably benign	Het
Lrp2	T	C	2: 69,527,555	I377V	probably benign	Het
Mavs	C	A	2: 131,242,024	T147N	probably damaging	Het
Mcoln2	C	T	3: 146,183,561	T374M	probably damaging	Het
Mreg	T	G	1: 72,162,375	T153P	probably damaging	Het
Naglu	T	C	11: 101,071,217	I172T	probably damaging	Het
Ogdhl	T	C	14: 32,339,328	V492A	possibly damaging	Het
Olfr1245	A	G	2: 89,575,630	I32T	possibly damaging	Het
Parvg	A	G	15: 84,337,882	E323G	probably benign	Het
Pgap1	A	G	1: 54,493,368	L664S	probably damaging	Het
Pgm2l1	A	G	7: 100,250,332	N51S	probably benign	Het
Pik3r6	A	G	11: 68,544,750	T609A	probably benign	Het
Plcb4	T	A	2: 135,971,856	V705E	probably damaging	Het
Plppr5	T	A	3: 117,671,889		probably null	Het
Prkg2	C	A	5: 98,973,130	D411Y	probably damaging	Het
Ptprd	A	G	4: 76,086,329	V63A	probably benign	Het
Ptprz1	T	A	6: 23,007,403	I1655N	probably damaging	Het
Raf1	T	A	6: 115,623,515	D10V	probably benign	Het
Rexo1	T	A	10: 80,544,378	Q928L	probably benign	Het
Rpl7l1	A	C	17: 46,778,530		probably null	Het
Rrm2b	A	G	15: 37,953,688	S39P	possibly damaging	Het
Scn5a	A	G	9: 119,492,047		probably null	Het
Sgtb	A	G	13: 104,129,260	T93A	probably benign	Het
Sigirr	G	T	7: 141,092,313		probably null	Het
Slc16a7	T	C	10: 125,228,082	D462G	probably benign	Het
Slc25a30	C	T	14: 75,769,649	A85T	probably benign	Het
Spata24	A	G	18: 35,656,834	S167P	probably damaging	Het
Spock3	C	T	8: 63,144,007	T115I	possibly damaging	Het
Srgap2	A	G	1: 131,319,551	I581T	possibly damaging	Het
Syn2	A	T	6: 115,135,147	M23L	unknown	Het
Synrg	G	A	11: 84,009,181	V839I	probably damaging	Het
Tmtc1	A	G	6: 148,412,829		probably benign	Het
Tnfaip3	C	A	10: 19,011,626	M50I	probably damaging	Het
Topbp1	T	A	9: 103,325,773	I721N	possibly damaging	Het
Ttc22	T	G	4: 106,636,806	V321G	probably benign	Het
Ttc25	A	T	11: 100,567,001	I477F	probably damaging	Het
Ubr2	A	G	17: 46,992,985		probably benign	Het
Ubr4	T	C	4: 139,437,058		probably benign	Het
Usp24	T	C	4: 106,412,084		probably benign	Het
Vmn2r100	A	T	17: 19,522,179	I272L	possibly damaging	Het
Vrtn	T	A	12: 84,648,605	L43H	probably damaging	Het
Wnk1	G	T	6: 120,037,149	R162S	probably damaging	Het
Xkr9	G	A	1: 13,684,062	W93*	probably null	Het
Zfp804b	G	T	5: 6,769,655	P1136H	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGCTTGCTTCGGGACACTTTC -3'
(R):5'- ACTCATCCAGCACTGTATGATTGGC -3'

Sequencing Primer
(F):5'- CGGGACACTTTCATCTTCAAGG -3'
(R):5'- GTCTGTTTCATCACTGAAGGGAAAG -3'

Posted On

2013-05-09