Incidental Mutation 'R4434:Opa1'
ID328779
Institutional Source Beutler Lab
Gene Symbol Opa1
Ensembl Gene ENSMUSG00000038084
Gene NameOPA1, mitochondrial dynamin like GTPase
Synonyms1200011N24Rik, lilr3
MMRRC Submission 041148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4434 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location29579334-29654884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29611983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 500 (I500M)
Ref Sequence ENSEMBL: ENSMUSP00000123880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038867] [ENSMUST00000160475] [ENSMUST00000160597] [ENSMUST00000161186]
Predicted Effect probably damaging
Transcript: ENSMUST00000038867
AA Change: I481M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036993
Gene: ENSMUSG00000038084
AA Change: I481M

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
coiled coil region 918 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160153
Predicted Effect probably damaging
Transcript: ENSMUST00000160475
AA Change: I481M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124739
Gene: ENSMUSG00000038084
AA Change: I481M

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
Blast:DYNc 608 632 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160597
AA Change: I463M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124223
Gene: ENSMUSG00000038084
AA Change: I463M

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 210 253 N/A INTRINSIC
DYNc 265 515 2.18e-10 SMART
coiled coil region 900 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161186
AA Change: I500M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123880
Gene: ENSMUSG00000038084
AA Change: I500M

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
DYNc 302 552 2.18e-10 SMART
coiled coil region 937 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162240
SMART Domains Protein: ENSMUSP00000124029
Gene: ENSMUSG00000038084

DomainStartEndE-ValueType
low complexity region 58 74 N/A INTRINSIC
coiled coil region 93 176 N/A INTRINSIC
Pfam:Dynamin_N 215 296 5.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a nuclear-encoded mitochondrial protein with similarity to dynamin-related GTPases. It is a component of the mitochondrial network. Mutations in this gene have been associated with optic atrophy type 1, which is a dominantly inherited optic neuropathy resulting in progressive loss of visual acuity, leading in many cases to legal blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit embryonic lethality, embryonic growth retardation and morphological abnormalities. Mice heterozygous for an ENU mutation exhibit abnormal cellular morphology, altered optic nerve myelination, abnormal responseto a new environment and decreased vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,054,621 Q907L probably null Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
AI597479 C T 1: 43,100,799 Q62* probably null Het
Akap9 T A 5: 4,032,708 M1944K probably damaging Het
Akr1c19 T C 13: 4,242,616 V212A probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Antxrl G A 14: 34,071,617 probably benign Het
Arhgap21 A G 2: 20,967,335 C26R probably benign Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Dnah7c G A 1: 46,666,282 R2485H probably damaging Het
Dnah9 T A 11: 66,108,075 N1049I possibly damaging Het
Dnaja3 T G 16: 4,689,995 Y120* probably null Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam208a G A 14: 27,449,861 probably null Het
Gcnt4 T A 13: 96,946,342 Y49N probably benign Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gngt1 A G 6: 3,994,282 D20G probably benign Het
Gnptab A G 10: 88,412,622 N104S probably damaging Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hectd1 A T 12: 51,752,052 I2095K probably damaging Het
Hephl1 C T 9: 15,076,796 R672H probably damaging Het
Hpse2 A G 19: 43,294,269 S182P probably benign Het
Itgb4 T A 11: 115,999,814 S1109R probably benign Het
Itgbl1 A T 14: 123,972,199 D330V probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Mycbp2 T A 14: 103,133,789 N4108Y probably damaging Het
Nampt T C 12: 32,838,363 I171T probably damaging Het
Nckap5l A C 15: 99,422,863 S1270A probably benign Het
Olfr16 C T 1: 172,957,544 H250Y probably damaging Het
Pax8 G A 2: 24,429,609 P350L possibly damaging Het
Plxnb2 A G 15: 89,162,803 C772R probably damaging Het
Prh1 A T 6: 132,571,878 H116L unknown Het
Rgsl1 C T 1: 153,802,341 A114T possibly damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scube1 A T 15: 83,721,924 I49N probably damaging Het
Shank3 C A 15: 89,503,359 L244I probably damaging Het
Shc3 T C 13: 51,449,266 T268A probably benign Het
Sp7 A G 15: 102,359,101 L90P probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tacstd2 A G 6: 67,535,144 V188A possibly damaging Het
Tex26 T C 5: 149,453,355 S70P probably benign Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Trim65 G A 11: 116,127,609 Q253* probably null Het
Tuba3a A T 6: 125,281,543 Y161* probably null Het
Zfand2b A G 1: 75,170,686 S197G possibly damaging Het
Zfp109 T A 7: 24,229,346 T213S probably benign Het
Zfp985 A C 4: 147,583,911 D412A probably benign Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Opa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Opa1 APN 16 29618115 splice site probably benign
IGL01087:Opa1 APN 16 29586997 missense probably damaging 1.00
IGL01799:Opa1 APN 16 29616658 missense possibly damaging 0.61
IGL01927:Opa1 APN 16 29586995 missense probably benign 0.35
IGL02067:Opa1 APN 16 29616655 missense probably damaging 1.00
IGL02317:Opa1 APN 16 29615166 critical splice donor site probably null
IGL02567:Opa1 APN 16 29588286 missense probably benign 0.01
IGL02826:Opa1 APN 16 29610887 missense probably null
Longshanks UTSW 16 29618259 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0092:Opa1 UTSW 16 29625594 missense probably damaging 0.99
R0114:Opa1 UTSW 16 29629635 missense probably benign 0.35
R0200:Opa1 UTSW 16 29614129 missense probably benign 0.08
R0308:Opa1 UTSW 16 29621531 missense probably damaging 0.98
R0427:Opa1 UTSW 16 29611461 missense probably damaging 0.98
R0671:Opa1 UTSW 16 29602207 splice site probably benign
R1768:Opa1 UTSW 16 29620810 missense probably benign
R1889:Opa1 UTSW 16 29625585 missense possibly damaging 0.67
R3932:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R3933:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R4618:Opa1 UTSW 16 29587039 missense probably damaging 1.00
R4926:Opa1 UTSW 16 29648973 missense possibly damaging 0.94
R5163:Opa1 UTSW 16 29597620 missense probably damaging 0.99
R5249:Opa1 UTSW 16 29618259 missense probably damaging 1.00
R5266:Opa1 UTSW 16 29618130 missense probably benign 0.19
R5275:Opa1 UTSW 16 29611579 missense probably damaging 1.00
R5372:Opa1 UTSW 16 29586119 missense probably benign 0.00
R5990:Opa1 UTSW 16 29587018 missense probably damaging 0.99
R6054:Opa1 UTSW 16 29615134 missense probably damaging 1.00
R6483:Opa1 UTSW 16 29628707 missense possibly damaging 0.72
R6522:Opa1 UTSW 16 29625514 missense probably benign 0.06
R6889:Opa1 UTSW 16 29620868 missense probably benign 0.22
R7225:Opa1 UTSW 16 29614039 splice site probably null
R7243:Opa1 UTSW 16 29586996 missense probably benign 0.01
R7324:Opa1 UTSW 16 29586981 missense probably benign
R7831:Opa1 UTSW 16 29648937 missense probably benign 0.02
R7914:Opa1 UTSW 16 29648937 missense probably benign 0.02
RF012:Opa1 UTSW 16 29613966 missense probably damaging 1.00
T0722:Opa1 UTSW 16 29610930 critical splice donor site probably null
X0065:Opa1 UTSW 16 29620784 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GATCTAAGCTGGGAAGTTTCTGC -3'
(R):5'- AGAGTACAGGTCTTAAGCCAGAC -3'

Sequencing Primer
(F):5'- AAGCTGGGAAGTTTCTGCTATTTTTC -3'
(R):5'- AGCCTACATTTTCAACTCGAGGG -3'
Posted On2015-07-21