Incidental Mutation 'R4434:Rln1'
ID328782
Institutional Source Beutler Lab
Gene Symbol Rln1
Ensembl Gene ENSMUSG00000039097
Gene Namerelaxin 1
Synonymsrlx
MMRRC Submission 041148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4434 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29331170-29334670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29334562 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 12 (F12Y)
Ref Sequence ENSEMBL: ENSMUSP00000043376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044143
AA Change: F12Y

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043376
Gene: ENSMUSG00000039097
AA Change: F12Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IlGF 33 185 6.34e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182039
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]
PHENOTYPE: Inactivation of this locus is compatible with fertility but not normal mammary gland development. Postpartum, homozygous mutant females exhibit slight nipples that are insufficient for suckling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,054,621 Q907L probably null Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
AI597479 C T 1: 43,100,799 Q62* probably null Het
Akap9 T A 5: 4,032,708 M1944K probably damaging Het
Akr1c19 T C 13: 4,242,616 V212A probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Antxrl G A 14: 34,071,617 probably benign Het
Arhgap21 A G 2: 20,967,335 C26R probably benign Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Dnah7c G A 1: 46,666,282 R2485H probably damaging Het
Dnah9 T A 11: 66,108,075 N1049I possibly damaging Het
Dnaja3 T G 16: 4,689,995 Y120* probably null Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam208a G A 14: 27,449,861 probably null Het
Gcnt4 T A 13: 96,946,342 Y49N probably benign Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gngt1 A G 6: 3,994,282 D20G probably benign Het
Gnptab A G 10: 88,412,622 N104S probably damaging Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hectd1 A T 12: 51,752,052 I2095K probably damaging Het
Hephl1 C T 9: 15,076,796 R672H probably damaging Het
Hpse2 A G 19: 43,294,269 S182P probably benign Het
Itgb4 T A 11: 115,999,814 S1109R probably benign Het
Itgbl1 A T 14: 123,972,199 D330V probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Mycbp2 T A 14: 103,133,789 N4108Y probably damaging Het
Nampt T C 12: 32,838,363 I171T probably damaging Het
Nckap5l A C 15: 99,422,863 S1270A probably benign Het
Olfr16 C T 1: 172,957,544 H250Y probably damaging Het
Opa1 A G 16: 29,611,983 I500M probably damaging Het
Pax8 G A 2: 24,429,609 P350L possibly damaging Het
Plxnb2 A G 15: 89,162,803 C772R probably damaging Het
Prh1 A T 6: 132,571,878 H116L unknown Het
Rgsl1 C T 1: 153,802,341 A114T possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scube1 A T 15: 83,721,924 I49N probably damaging Het
Shank3 C A 15: 89,503,359 L244I probably damaging Het
Shc3 T C 13: 51,449,266 T268A probably benign Het
Sp7 A G 15: 102,359,101 L90P probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tacstd2 A G 6: 67,535,144 V188A possibly damaging Het
Tex26 T C 5: 149,453,355 S70P probably benign Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Trim65 G A 11: 116,127,609 Q253* probably null Het
Tuba3a A T 6: 125,281,543 Y161* probably null Het
Zfand2b A G 1: 75,170,686 S197G possibly damaging Het
Zfp109 T A 7: 24,229,346 T213S probably benign Het
Zfp985 A C 4: 147,583,911 D412A probably benign Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Rln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Rln1 APN 19 29332014 missense possibly damaging 0.84
IGL01607:Rln1 APN 19 29331860 missense probably benign 0.02
IGL02415:Rln1 APN 19 29334398 missense probably damaging 0.97
R0184:Rln1 UTSW 19 29331936 nonsense probably null
R1670:Rln1 UTSW 19 29332068 missense possibly damaging 0.95
R1965:Rln1 UTSW 19 29334595 start codon destroyed probably null 0.53
R4437:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R4438:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R5525:Rln1 UTSW 19 29334520 missense probably benign 0.44
R6484:Rln1 UTSW 19 29334502 missense probably benign
R6648:Rln1 UTSW 19 29332121 missense probably benign 0.28
R7624:Rln1 UTSW 19 29332099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCAGCCAATGGGAAGCATG -3'
(R):5'- AGACAATACCACGCAGGCTG -3'

Sequencing Primer
(F):5'- TGAGAAGGCGCTCACCAGTG -3'
(R):5'- CACGCAGGCTGAGGGTG -3'
Posted On2015-07-21