Incidental Mutation 'R4447:Fam129a'
ID328786
Institutional Source Beutler Lab
Gene Symbol Fam129a
Ensembl Gene ENSMUSG00000026483
Gene Namefamily with sequence similarity 129, member A
SynonymsNiban
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151571186-151721939 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 151636402 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097541] [ENSMUST00000111875] [ENSMUST00000111875] [ENSMUST00000134499] [ENSMUST00000134499] [ENSMUST00000148810]
Predicted Effect probably benign
Transcript: ENSMUST00000097541
SMART Domains Protein: ENSMUSP00000095148
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
Blast:PH 70 197 2e-83 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111875
SMART Domains Protein: ENSMUSP00000107506
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
Blast:PH 70 197 6e-86 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111875
SMART Domains Protein: ENSMUSP00000107506
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
Blast:PH 70 197 6e-86 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000134499
SMART Domains Protein: ENSMUSP00000115692
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 114 5e-3 SMART
Blast:PH 70 114 3e-23 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000134499
SMART Domains Protein: ENSMUSP00000115692
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 114 5e-3 SMART
Blast:PH 70 114 3e-23 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000148810
SMART Domains Protein: ENSMUSP00000115822
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 118 1e-2 SMART
Blast:PH 70 197 1e-80 BLAST
low complexity region 540 549 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
low complexity region 784 797 N/A INTRINSIC
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family with sequence similarity 129 protein family. This gene is highly expressed in several cancer cells and may serve as a prognostic marker for certain cancers. The encoded protein may play a role in regulating p53-mediated apoptosis. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable with no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Fam129a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Fam129a APN 1 151717721 missense probably benign 0.06
IGL01690:Fam129a APN 1 151703804 missense probably damaging 1.00
IGL01762:Fam129a APN 1 151636491 missense probably damaging 1.00
IGL01784:Fam129a APN 1 151649365 missense probably damaging 1.00
IGL01938:Fam129a APN 1 151689614 missense probably benign 0.22
IGL02427:Fam129a APN 1 151717274 missense probably damaging 1.00
IGL02617:Fam129a APN 1 151571545 missense probably benign 0.11
IGL02946:Fam129a APN 1 151649425 missense probably damaging 0.99
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0279:Fam129a UTSW 1 151709206 critical splice donor site probably null
R0421:Fam129a UTSW 1 151709082 splice site probably benign
R0531:Fam129a UTSW 1 151718084 missense probably benign 0.11
R0725:Fam129a UTSW 1 151706015 missense probably benign 0.04
R1493:Fam129a UTSW 1 151706090 missense probably damaging 1.00
R1563:Fam129a UTSW 1 151715673 missense possibly damaging 0.69
R1868:Fam129a UTSW 1 151641551 missense possibly damaging 0.71
R1944:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R1945:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R2071:Fam129a UTSW 1 151636430 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151696135 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151709133 missense possibly damaging 0.94
R2138:Fam129a UTSW 1 151696251 missense probably damaging 0.98
R2180:Fam129a UTSW 1 151718078 missense probably benign 0.02
R2402:Fam129a UTSW 1 151689614 missense probably benign 0.22
R3689:Fam129a UTSW 1 151703696 splice site probably null
R3783:Fam129a UTSW 1 151689648 missense possibly damaging 0.66
R3975:Fam129a UTSW 1 151649335 missense probably damaging 1.00
R4029:Fam129a UTSW 1 151695690 missense probably benign 0.00
R4328:Fam129a UTSW 1 151636418 missense possibly damaging 0.86
R4573:Fam129a UTSW 1 151703766 missense possibly damaging 0.85
R4774:Fam129a UTSW 1 151715694 missense probably damaging 1.00
R5064:Fam129a UTSW 1 151689659 missense probably benign 0.05
R5077:Fam129a UTSW 1 151714523 missense probably benign 0.00
R5187:Fam129a UTSW 1 151703829 missense possibly damaging 0.50
R5484:Fam129a UTSW 1 151718086 missense probably benign 0.08
R5553:Fam129a UTSW 1 151717235 missense probably damaging 0.99
R5572:Fam129a UTSW 1 151709190 missense probably benign 0.05
R5575:Fam129a UTSW 1 151718240 missense probably benign 0.31
R5586:Fam129a UTSW 1 151717556 missense probably benign 0.00
R5697:Fam129a UTSW 1 151700261 missense probably damaging 1.00
R6305:Fam129a UTSW 1 151695718 missense probably damaging 1.00
R7065:Fam129a UTSW 1 151700107 critical splice acceptor site probably null
R7126:Fam129a UTSW 1 151714567 nonsense probably null
R7392:Fam129a UTSW 1 151696224 missense probably damaging 1.00
R7571:Fam129a UTSW 1 151718297 missense probably benign 0.01
R7577:Fam129a UTSW 1 151718312 missense probably benign
R7939:Fam129a UTSW 1 151706024 missense probably damaging 1.00
R8018:Fam129a UTSW 1 151717255 nonsense probably null
R8164:Fam129a UTSW 1 151717588 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAAAGACTCCTCCTCCTCCTG -3'
(R):5'- TCTGGCAAGAGAACGATGTAAGTC -3'

Sequencing Primer
(F):5'- CTCCTGACTGGTCCTTGGG -3'
(R):5'- TCGAGTGCTCAAGAGTCACCTTG -3'
Posted On2015-07-21