Mutagenetix > Incidental Mutations

Incidental Mutation 'R4447:Zscan29'

328790

Institutional Source

Beutler Lab

Gene Symbol

Zscan29

Ensembl Gene

ENSMUSG00000050619

Gene Name

zinc finger SCAN domains 29

Synonyms

Zfp690

MMRRC Submission

041708-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R4447 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121158273-121171125 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 121169886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000079024] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000110661] [ENSMUST00000146243] [ENSMUST00000163766] [ENSMUST00000186659]

AlphaFold

E9Q5B4

Predicted Effect

probably null
Transcript: ENSMUST00000039541

SMART Domains

Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	4	573	2.8e-111	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079024
AA Change: Q80L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619
AA Change: Q80L

Domain	Start	End	E-Value	Type
SCAN	13	125	5.83e-70	SMART
Pfam:Myb_DNA-bind_4	238	323	3e-21	PFAM
Pfam:Myb_DNA-bind_4	399	484	4.1e-22	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110657

SMART Domains

Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	4	572	3.1e-115	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110658

SMART Domains

Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	4	572	4.1e-115	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110661
AA Change: Q80L

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619
AA Change: Q80L

Domain	Start	End	E-Value	Type
SCAN	13	125	5.83e-70	SMART
Pfam:Myb_DNA-bind_4	238	323	5.4e-21	PFAM
Pfam:Myb_DNA-bind_4	399	484	7.4e-22	PFAM
low complexity region	518	532	N/A	INTRINSIC
ZnF_C2H2	665	687	2.99e-4	SMART
ZnF_C2H2	693	715	2.75e-3	SMART
ZnF_C2H2	721	743	8.02e-5	SMART
ZnF_C2H2	749	771	1.13e-4	SMART
ZnF_C2H2	777	799	1.18e-2	SMART
ZnF_C2H2	805	827	1.33e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130929

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133773

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135555

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144076

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144123

Predicted Effect

probably damaging
Transcript: ENSMUST00000146243
AA Change: Q80L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619
AA Change: Q80L

Domain	Start	End	E-Value	Type
SCAN	13	118	4.23e-58	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154633

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163766
AA Change: Q80L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619
AA Change: Q80L

Domain	Start	End	E-Value	Type
SCAN	13	125	5.83e-70	SMART
Pfam:Myb_DNA-bind_4	238	323	5.9e-21	PFAM
Pfam:Myb_DNA-bind_4	434	519	1.3e-21	PFAM
low complexity region	553	567	N/A	INTRINSIC
ZnF_C2H2	700	722	2.99e-4	SMART
ZnF_C2H2	728	750	2.75e-3	SMART
ZnF_C2H2	756	778	8.02e-5	SMART
ZnF_C2H2	784	806	1.13e-4	SMART
ZnF_C2H2	812	834	1.18e-2	SMART
ZnF_C2H2	840	862	1.33e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000186659

SMART Domains

Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	4	572	4.1e-115	PFAM

Meta Mutation Damage Score

0.3513

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,198	T603A	probably benign	Het
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsf2	G	T	11: 94,569,359	P389Q	possibly damaging	Het
Aldh6a1	A	G	12: 84,439,709	V120A	possibly damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Ankar	A	G	1: 72,687,789	S415P	possibly damaging	Het
Ano3	A	T	2: 110,761,578		probably null	Het
Asic4	A	T	1: 75,470,370		probably benign	Het
Atp1a4	A	C	1: 172,234,431	I709S	probably damaging	Het
Cyp11b2	T	C	15: 74,855,563	I90V	probably benign	Het
Fam129a	A	T	1: 151,636,402		probably null	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Irf5	T	A	6: 29,535,942	D318E	probably damaging	Het
Map2k3	A	T	11: 60,947,171	S253C	probably damaging	Het
Mgst1	G	T	6: 138,141,664		probably benign	Het
Mipol1	G	T	12: 57,352,748		probably benign	Het
Olfr371	T	A	8: 85,231,366	Y290*	probably null	Het
Pomgnt1	G	T	4: 116,152,923	V161L	possibly damaging	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Rxfp1	C	T	3: 79,652,127		probably benign	Het
Scn5a	T	C	9: 119,550,627	D197G	probably damaging	Het
Thsd7a	G	A	6: 12,324,635	T1479I	probably damaging	Het
Twsg1	C	T	17: 65,929,787	D83N	possibly damaging	Het
Ubqln3	C	T	7: 104,142,814	R23Q	probably benign	Het
Vmn1r228	T	C	17: 20,777,107	I50V	probably damaging	Het
Wnk4	T	A	11: 101,268,451	S565T	possibly damaging	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het
Zfp407	A	T	18: 84,562,694	V98D	possibly damaging	Het
Zfp598	T	A	17: 24,676,555	V73E	probably damaging	Het

Other mutations in Zscan29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01935:Zscan29	APN	2	121170057	missense	probably damaging	1.00
IGL01938:Zscan29	APN	2	121166209	missense	probably benign	0.16
IGL02220:Zscan29	APN	2	121166689	missense	probably damaging	0.99
IGL02370:Zscan29	APN	2	121163833	missense	probably benign	0.00
IGL02585:Zscan29	APN	2	121163876	nonsense	probably null
R0284:Zscan29	UTSW	2	121166733	unclassified	probably benign
R0842:Zscan29	UTSW	2	121161479	missense	possibly damaging	0.84
R1245:Zscan29	UTSW	2	121166503	missense	probably damaging	1.00
R1586:Zscan29	UTSW	2	121161160	missense	probably damaging	1.00
R1654:Zscan29	UTSW	2	121164779	missense	probably benign	0.06
R1958:Zscan29	UTSW	2	121169808	critical splice donor site	probably null
R2073:Zscan29	UTSW	2	121160855	nonsense	probably null
R2085:Zscan29	UTSW	2	121169946	nonsense	probably null
R2145:Zscan29	UTSW	2	121170106	missense	probably damaging	1.00
R2201:Zscan29	UTSW	2	121169402	missense	probably damaging	1.00
R2875:Zscan29	UTSW	2	121164100	missense	probably damaging	1.00
R2876:Zscan29	UTSW	2	121164100	missense	probably damaging	1.00
R3861:Zscan29	UTSW	2	121160731	missense	probably benign	0.01
R4244:Zscan29	UTSW	2	121164794	splice site	probably null
R4245:Zscan29	UTSW	2	121164794	splice site	probably null
R4662:Zscan29	UTSW	2	121166615	missense	probably benign	0.26
R4757:Zscan29	UTSW	2	121160911	missense	possibly damaging	0.92
R4777:Zscan29	UTSW	2	121169324	missense	probably damaging	0.96
R4905:Zscan29	UTSW	2	121161383	missense	possibly damaging	0.53
R4970:Zscan29	UTSW	2	121169195	splice site	probably null
R5860:Zscan29	UTSW	2	121164037	missense	probably damaging	1.00
R5861:Zscan29	UTSW	2	121164037	missense	probably damaging	1.00
R5862:Zscan29	UTSW	2	121164037	missense	probably damaging	1.00
R5916:Zscan29	UTSW	2	121164037	missense	probably damaging	1.00
R5917:Zscan29	UTSW	2	121164037	missense	probably damaging	1.00
R5918:Zscan29	UTSW	2	121164037	missense	probably damaging	1.00
R6335:Zscan29	UTSW	2	121161436	missense	possibly damaging	0.49
R7214:Zscan29	UTSW	2	121169280	nonsense	probably null
R7326:Zscan29	UTSW	2	121160988	missense	probably damaging	1.00
R7997:Zscan29	UTSW	2	121160740	missense	probably benign	0.01
R8787:Zscan29	UTSW	2	121166395	missense	probably damaging	1.00
RF001:Zscan29	UTSW	2	121163996	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GTAGGCATCTCCAAGCAAGC -3'
(R):5'- CGCTTCAGAAGATTCCATTACCAG -3'

Sequencing Primer
(F):5'- GTAACCCTTCCAGATCAGAAGTATC -3'
(R):5'- CCAGGAGGTGGCTGGGC -3'

Posted On

2015-07-21