Incidental Mutation 'R4447:Rxfp1'
ID 328791
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Name relaxin/insulin-like family peptide receptor 1
Synonyms LOC381489, Lgr7
MMRRC Submission 041708-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R4447 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 79548918-79645187 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) C to T at 79559434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
AlphaFold Q6R6I7
Predicted Effect probably benign
Transcript: ENSMUST00000078527
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183199
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,976,129 (GRCm39) noncoding transcript Het
Acsf2 G T 11: 94,460,185 (GRCm39) P389Q possibly damaging Het
Aldh6a1 A G 12: 84,486,483 (GRCm39) V120A possibly damaging Het
Alg11 C A 8: 22,558,095 (GRCm39) A469E probably benign Het
Ankar A G 1: 72,726,948 (GRCm39) S415P possibly damaging Het
Ano3 A T 2: 110,591,923 (GRCm39) probably null Het
Asic4 A T 1: 75,447,014 (GRCm39) probably benign Het
Atp1a4 A C 1: 172,061,998 (GRCm39) I709S probably damaging Het
Cyp11b2 T C 15: 74,727,412 (GRCm39) I90V probably benign Het
Galnt2 A G 8: 125,022,116 (GRCm39) D14G probably benign Het
Iqcm T C 8: 76,356,394 (GRCm39) S176P probably damaging Het
Irf5 T A 6: 29,535,941 (GRCm39) D318E probably damaging Het
Map2k3 A T 11: 60,837,997 (GRCm39) S253C probably damaging Het
Mgst1 G T 6: 138,118,662 (GRCm39) probably benign Het
Mipol1 G T 12: 57,399,534 (GRCm39) probably benign Het
Niban1 A T 1: 151,512,153 (GRCm39) probably null Het
Or7c19 T A 8: 85,957,995 (GRCm39) Y290* probably null Het
Pomgnt1 G T 4: 116,010,120 (GRCm39) V161L possibly damaging Het
Rnpc3 T C 3: 113,404,786 (GRCm39) probably benign Het
Scn5a T C 9: 119,379,693 (GRCm39) D197G probably damaging Het
Spata31d1e T C 13: 59,890,012 (GRCm39) T603A probably benign Het
Thsd7a G A 6: 12,324,634 (GRCm39) T1479I probably damaging Het
Twsg1 C T 17: 66,236,782 (GRCm39) D83N possibly damaging Het
Ubqln3 C T 7: 103,792,021 (GRCm39) R23Q probably benign Het
Vmn1r228 T C 17: 20,997,369 (GRCm39) I50V probably damaging Het
Wnk4 T A 11: 101,159,277 (GRCm39) S565T possibly damaging Het
Wwc2 A G 8: 48,321,702 (GRCm39) Y471H unknown Het
Zfp407 A T 18: 84,580,819 (GRCm39) V98D possibly damaging Het
Zfp598 T A 17: 24,895,529 (GRCm39) V73E probably damaging Het
Zscan29 T A 2: 121,000,367 (GRCm39) probably null Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79,559,523 (GRCm39) missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79,594,175 (GRCm39) missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79,567,385 (GRCm39) missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79,567,403 (GRCm39) missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79,557,799 (GRCm39) missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79,567,427 (GRCm39) missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79,559,474 (GRCm39) critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79,578,153 (GRCm39) critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79,559,533 (GRCm39) missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79,574,990 (GRCm39) missense probably benign 0.29
juggler UTSW 3 79,557,898 (GRCm39) nonsense probably null
R0123:Rxfp1 UTSW 3 79,564,783 (GRCm39) missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79,564,783 (GRCm39) missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79,552,282 (GRCm39) missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79,589,842 (GRCm39) missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79,574,961 (GRCm39) missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79,645,100 (GRCm39) start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79,559,684 (GRCm39) missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79,558,038 (GRCm39) missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79,612,876 (GRCm39) splice site probably null
R0627:Rxfp1 UTSW 3 79,555,518 (GRCm39) missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79,570,600 (GRCm39) splice site probably null
R1309:Rxfp1 UTSW 3 79,570,599 (GRCm39) splice site probably null
R1756:Rxfp1 UTSW 3 79,578,188 (GRCm39) missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79,645,076 (GRCm39) missense probably benign
R2415:Rxfp1 UTSW 3 79,570,626 (GRCm39) missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79,589,778 (GRCm39) missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79,552,256 (GRCm39) missense probably damaging 0.99
R4091:Rxfp1 UTSW 3 79,552,068 (GRCm39) missense probably benign
R4250:Rxfp1 UTSW 3 79,559,579 (GRCm39) missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79,594,105 (GRCm39) critical splice donor site probably null
R4607:Rxfp1 UTSW 3 79,594,196 (GRCm39) missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79,594,196 (GRCm39) missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79,612,975 (GRCm39) missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79,594,175 (GRCm39) missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79,557,889 (GRCm39) missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79,552,109 (GRCm39) missense probably benign
R5059:Rxfp1 UTSW 3 79,570,619 (GRCm39) missense probably benign
R5131:Rxfp1 UTSW 3 79,559,471 (GRCm39) splice site probably null
R5641:Rxfp1 UTSW 3 79,594,199 (GRCm39) missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79,586,054 (GRCm39) missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79,568,627 (GRCm39) missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79,570,620 (GRCm39) missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79,575,155 (GRCm39) missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79,555,596 (GRCm39) missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79,557,898 (GRCm39) nonsense probably null
R7059:Rxfp1 UTSW 3 79,559,576 (GRCm39) missense probably damaging 1.00
R7530:Rxfp1 UTSW 3 79,557,768 (GRCm39) missense probably benign 0.18
R7626:Rxfp1 UTSW 3 79,555,397 (GRCm39) missense probably damaging 0.99
R7684:Rxfp1 UTSW 3 79,578,214 (GRCm39) missense possibly damaging 0.66
R7951:Rxfp1 UTSW 3 79,559,682 (GRCm39) missense probably damaging 1.00
R8723:Rxfp1 UTSW 3 79,557,802 (GRCm39) missense probably benign
R8786:Rxfp1 UTSW 3 79,570,677 (GRCm39) critical splice acceptor site probably null
R8887:Rxfp1 UTSW 3 79,559,289 (GRCm39) intron probably benign
R8939:Rxfp1 UTSW 3 79,552,231 (GRCm39) missense probably damaging 0.99
R9245:Rxfp1 UTSW 3 79,552,261 (GRCm39) missense probably benign 0.12
R9574:Rxfp1 UTSW 3 79,563,581 (GRCm39) missense probably benign 0.01
R9579:Rxfp1 UTSW 3 79,557,946 (GRCm39) missense probably damaging 1.00
R9799:Rxfp1 UTSW 3 79,578,182 (GRCm39) missense probably damaging 1.00
Z1088:Rxfp1 UTSW 3 79,613,011 (GRCm39) missense probably damaging 1.00
Z1177:Rxfp1 UTSW 3 79,559,674 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGCTGTAACATCCTGAAGTC -3'
(R):5'- TCATCCAGAGAGTCTTTGTCTG -3'

Sequencing Primer
(F):5'- CAATCTCACTTGGAGACATTTC -3'
(R):5'- GGGTTGTATCTGCCATTACCTGC -3'
Posted On 2015-07-21