Mutagenetix > Incidental Mutations

Incidental Mutation 'R4447:Rxfp1'

328791

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

Lgr7, LOC381489

MMRRC Submission

041708-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R4447 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79641611-79737880 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 79652127 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

Predicted Effect

probably benign
Transcript: ENSMUST00000078527

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182491

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183040

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183199

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,198	T603A	probably benign	Het
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsf2	G	T	11: 94,569,359	P389Q	possibly damaging	Het
Aldh6a1	A	G	12: 84,439,709	V120A	possibly damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Ankar	A	G	1: 72,687,789	S415P	possibly damaging	Het
Ano3	A	T	2: 110,761,578		probably null	Het
Asic4	A	T	1: 75,470,370		probably benign	Het
Atp1a4	A	C	1: 172,234,431	I709S	probably damaging	Het
Cyp11b2	T	C	15: 74,855,563	I90V	probably benign	Het
Fam129a	A	T	1: 151,636,402		probably null	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Irf5	T	A	6: 29,535,942	D318E	probably damaging	Het
Map2k3	A	T	11: 60,947,171	S253C	probably damaging	Het
Mgst1	G	T	6: 138,141,664		probably benign	Het
Mipol1	G	T	12: 57,352,748		probably benign	Het
Olfr371	T	A	8: 85,231,366	Y290*	probably null	Het
Pomgnt1	G	T	4: 116,152,923	V161L	possibly damaging	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Scn5a	T	C	9: 119,550,627	D197G	probably damaging	Het
Thsd7a	G	A	6: 12,324,635	T1479I	probably damaging	Het
Twsg1	C	T	17: 65,929,787	D83N	possibly damaging	Het
Ubqln3	C	T	7: 104,142,814	R23Q	probably benign	Het
Vmn1r228	T	C	17: 20,777,107	I50V	probably damaging	Het
Wnk4	T	A	11: 101,268,451	S565T	possibly damaging	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het
Zfp407	A	T	18: 84,562,694	V98D	possibly damaging	Het
Zfp598	T	A	17: 24,676,555	V73E	probably damaging	Het
Zscan29	T	A	2: 121,169,886		probably null	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79652216	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79686868	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79660078	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79660096	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79650492	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79660120	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79652167	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79670846	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79652226	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79667683	missense	probably benign	0.29
juggler	UTSW	3	79650591	nonsense	probably null
R0123:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79644975	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79682535	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79667654	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79737793	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79652377	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79650731	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79705569	splice site	probably null
R0627:Rxfp1	UTSW	3	79648211	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79663293	splice site	probably null
R1309:Rxfp1	UTSW	3	79663292	splice site	probably null
R1756:Rxfp1	UTSW	3	79670881	missense	probably benign	0.11
R1803:Rxfp1	UTSW	3	79737769	missense	probably benign
R2415:Rxfp1	UTSW	3	79663319	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79682471	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79644949	missense	probably damaging	0.99
R4091:Rxfp1	UTSW	3	79644761	missense	probably benign
R4250:Rxfp1	UTSW	3	79652272	missense	probably benign	0.41
R4335:Rxfp1	UTSW	3	79686798	critical splice donor site	probably null
R4607:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4676:Rxfp1	UTSW	3	79705668	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79686868	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79650582	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79644802	missense	probably benign
R5059:Rxfp1	UTSW	3	79663312	missense	probably benign
R5131:Rxfp1	UTSW	3	79652164	splice site	probably null
R5641:Rxfp1	UTSW	3	79686892	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79678747	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79661320	missense	possibly damaging	0.89
R5856:Rxfp1	UTSW	3	79663313	missense	possibly damaging	0.76
R6296:Rxfp1	UTSW	3	79667848	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79648289	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79650591	nonsense	probably null
R7059:Rxfp1	UTSW	3	79652269	missense	probably damaging	1.00
R7530:Rxfp1	UTSW	3	79650461	missense	probably benign	0.18
R7626:Rxfp1	UTSW	3	79648090	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79670907	missense	possibly damaging	0.66
R7951:Rxfp1	UTSW	3	79652375	missense	probably damaging	1.00
Z1088:Rxfp1	UTSW	3	79705704	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79652367	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGGCTGTAACATCCTGAAGTC -3'
(R):5'- TCATCCAGAGAGTCTTTGTCTG -3'

Sequencing Primer
(F):5'- CAATCTCACTTGGAGACATTTC -3'
(R):5'- GGGTTGTATCTGCCATTACCTGC -3'

Posted On

2015-07-21