Incidental Mutation 'R4447:Rnpc3'
ID328792
Institutional Source Beutler Lab
Gene Symbol Rnpc3
Ensembl Gene ENSMUSG00000027981
Gene NameRNA-binding region (RNP1, RRM) containing 3
Synonyms
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location113605067-113630149 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 113611137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092154] [ENSMUST00000106535] [ENSMUST00000106536] [ENSMUST00000174147]
Predicted Effect probably benign
Transcript: ENSMUST00000092154
SMART Domains Protein: ENSMUSP00000089792
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106535
SMART Domains Protein: ENSMUSP00000102145
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 4.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106536
SMART Domains Protein: ENSMUSP00000102146
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132220
Predicted Effect probably benign
Transcript: ENSMUST00000153853
SMART Domains Protein: ENSMUSP00000115492
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
Blast:RRM 2 47 8e-22 BLAST
SCOP:d1urna_ 3 53 4e-4 SMART
low complexity region 167 202 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
RRM 368 446 1.35e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174147
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Rnpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Rnpc3 APN 3 113608399 missense probably damaging 1.00
IGL02750:Rnpc3 APN 3 113621939 missense possibly damaging 0.81
R0316:Rnpc3 UTSW 3 113629973 missense probably damaging 1.00
R0420:Rnpc3 UTSW 3 113621869 missense probably benign 0.00
R0601:Rnpc3 UTSW 3 113620106 missense probably benign 0.18
R1051:Rnpc3 UTSW 3 113629946 missense possibly damaging 0.94
R1386:Rnpc3 UTSW 3 113613784 nonsense probably null
R1865:Rnpc3 UTSW 3 113621910 nonsense probably null
R1870:Rnpc3 UTSW 3 113611055 unclassified probably benign
R2045:Rnpc3 UTSW 3 113608360 missense possibly damaging 0.90
R4450:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4934:Rnpc3 UTSW 3 113624979 missense possibly damaging 0.86
R5436:Rnpc3 UTSW 3 113624999 missense probably damaging 1.00
R5474:Rnpc3 UTSW 3 113615509 nonsense probably null
R5498:Rnpc3 UTSW 3 113611207 critical splice donor site probably null
R5505:Rnpc3 UTSW 3 113615453 missense probably damaging 0.98
R5868:Rnpc3 UTSW 3 113616711 splice site probably null
R6123:Rnpc3 UTSW 3 113609056 splice site probably null
R7220:Rnpc3 UTSW 3 113628355 missense probably benign 0.01
R7240:Rnpc3 UTSW 3 113616831 missense probably damaging 1.00
R7507:Rnpc3 UTSW 3 113616761 missense probably benign
R7537:Rnpc3 UTSW 3 113613832 missense probably benign
R7818:Rnpc3 UTSW 3 113629951 missense probably damaging 1.00
R7872:Rnpc3 UTSW 3 113622447 nonsense probably null
RF023:Rnpc3 UTSW 3 113620074 missense probably damaging 0.98
X0012:Rnpc3 UTSW 3 113629909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAAAAGCTTAGGCACAAAACAG -3'
(R):5'- TGCTACTGTTGTCTGCTGTAAAC -3'

Sequencing Primer
(F):5'- GCAGCTTTCATAGTAGGAAAAACAC -3'
(R):5'- GCCTTTTTAGCATTTACAATGGAGTG -3'
Posted On2015-07-21