Incidental Mutation 'R4447:Irf5'
ID328796
Institutional Source Beutler Lab
Gene Symbol Irf5
Ensembl Gene ENSMUSG00000029771
Gene Nameinterferon regulatory factor 5
Synonymsmirf5
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29526625-29541871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29535942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 318 (D318E)
Ref Sequence ENSEMBL: ENSMUSP00000127021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004392] [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000163511] [ENSMUST00000164626] [ENSMUST00000164922] [ENSMUST00000167252]
Predicted Effect probably damaging
Transcript: ENSMUST00000004392
AA Change: D318E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004392
Gene: ENSMUSG00000029771
AA Change: D318E

DomainStartEndE-ValueType
IRF 10 123 6.39e-63 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.67e-89 SMART
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000012679
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115251
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163511
AA Change: D318E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127021
Gene: ENSMUSG00000029771
AA Change: D318E

DomainStartEndE-ValueType
IRF 10 123 6.39e-63 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.67e-89 SMART
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164626
SMART Domains Protein: ENSMUSP00000130548
Gene: ENSMUSG00000029771

DomainStartEndE-ValueType
IRF 10 80 9.78e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164922
SMART Domains Protein: ENSMUSP00000145299
Gene: ENSMUSG00000029771

DomainStartEndE-ValueType
IRF 1 86 7.7e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167252
AA Change: D318E

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126273
Gene: ENSMUSG00000029771
AA Change: D318E

DomainStartEndE-ValueType
IRF 10 123 2.8e-65 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.3e-93 SMART
Meta Mutation Damage Score 0.1081 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice exhibit resistance to lethal shock with a marked decrease in the serum levels of proinflammatory cytokines, but normal B cell development. Mice homozygous for another allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Irf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Irf5 APN 6 29536103 missense probably damaging 1.00
IGL02405:Irf5 APN 6 29535761 missense probably damaging 0.99
IGL02953:Irf5 APN 6 29536672 missense possibly damaging 0.76
R0099:Irf5 UTSW 6 29533967 missense probably damaging 0.98
R0116:Irf5 UTSW 6 29536109 missense probably damaging 1.00
R0482:Irf5 UTSW 6 29535370 missense probably benign 0.00
R1827:Irf5 UTSW 6 29536673 missense possibly damaging 0.67
R1938:Irf5 UTSW 6 29536739 missense probably benign 0.05
R3969:Irf5 UTSW 6 29536782 missense probably benign 0.00
R4408:Irf5 UTSW 6 29534001 splice site probably null
R4828:Irf5 UTSW 6 29531141 missense probably damaging 0.99
R5555:Irf5 UTSW 6 29531146 missense probably benign 0.00
R5891:Irf5 UTSW 6 29529425 intron probably benign
R6148:Irf5 UTSW 6 29535959 missense probably damaging 1.00
R7084:Irf5 UTSW 6 29535877 missense probably damaging 0.98
R7274:Irf5 UTSW 6 29534040 missense probably damaging 1.00
R7832:Irf5 UTSW 6 29535462 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGTGACGGACCTAGAGATC -3'
(R):5'- ACCATTGAGAAACTGCTCTAGGC -3'

Sequencing Primer
(F):5'- CTAGAGATCAAGTTCCAGTACCGG -3'
(R):5'- GCTAAAGAGCTTCGTCTTGAC -3'
Posted On2015-07-21