Incidental Mutation 'R4447:3930402G23Rik'
ID328799
Institutional Source Beutler Lab
Gene Symbol 3930402G23Rik
Ensembl Gene ENSMUSG00000038917
Gene NameRIKEN cDNA 3930402G23 gene
Synonyms
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location10924427-10928457 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 10926129 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040608
SMART Domains Protein: ENSMUSP00000044199
Gene: ENSMUSG00000038917

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
low complexity region 62 68 N/A INTRINSIC
low complexity region 81 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208615
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in 3930402G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0113:3930402G23Rik UTSW 8 10926126 unclassified noncoding transcript
R4448:3930402G23Rik UTSW 8 10926129 unclassified noncoding transcript
R4450:3930402G23Rik UTSW 8 10926129 unclassified noncoding transcript
R4653:3930402G23Rik UTSW 8 10926075 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TAATCCTCTCGGGCATGTGAG -3'
(R):5'- GTTAGCACAAGAGGTCCTGC -3'

Sequencing Primer
(F):5'- AGCTAACTCTGGCCCGGTATTTG -3'
(R):5'- TCCTGCGGAGGAAGCACTAG -3'
Posted On2015-07-21