Incidental Mutation 'R4447:Alg11'
ID328800
Institutional Source Beutler Lab
Gene Symbol Alg11
Ensembl Gene ENSMUSG00000063362
Gene Nameasparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)
Synonyms
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22060721-22071627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22068079 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 469 (A469E)
Ref Sequence ENSEMBL: ENSMUSP00000072382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072572] [ENSMUST00000110737]
Predicted Effect probably benign
Transcript: ENSMUST00000072572
AA Change: A469E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072382
Gene: ENSMUSG00000063362
AA Change: A469E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:ALG11_N 62 269 2.6e-94 PFAM
Pfam:Glycos_transf_1 293 470 1.4e-30 PFAM
Pfam:Glyco_trans_1_4 301 454 8.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110737
AA Change: A427E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106365
Gene: ENSMUSG00000063362
AA Change: A427E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
Pfam:Glycos_transf_1 248 428 3.8e-29 PFAM
Pfam:Glyco_trans_1_4 259 412 7.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131624
SMART Domains Protein: ENSMUSP00000119161
Gene: ENSMUSG00000063362

DomainStartEndE-ValueType
Pfam:ALG11_N 4 160 1.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134474
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Alg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Alg11 APN 8 22061983 missense probably benign 0.22
1mM(1):Alg11 UTSW 8 22074057 missense probably benign
R0240:Alg11 UTSW 8 22065452 missense possibly damaging 0.83
R1908:Alg11 UTSW 8 22065568 missense probably damaging 1.00
R1980:Alg11 UTSW 8 22061887 missense possibly damaging 0.69
R2090:Alg11 UTSW 8 22065630 missense possibly damaging 0.80
R2147:Alg11 UTSW 8 22065293 missense probably damaging 1.00
R2159:Alg11 UTSW 8 22065845 missense probably benign 0.44
R2265:Alg11 UTSW 8 22065614 missense probably benign
R2760:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2761:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2762:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2763:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2764:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2877:Alg11 UTSW 8 22065358 missense possibly damaging 0.93
R4165:Alg11 UTSW 8 22065557 missense probably damaging 1.00
R4230:Alg11 UTSW 8 22065518 missense probably damaging 1.00
R4370:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4371:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4448:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4450:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4840:Alg11 UTSW 8 22068010 missense possibly damaging 0.91
R5859:Alg11 UTSW 8 22065841 missense probably benign 0.10
R5988:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7293:Alg11 UTSW 8 22065379 missense probably damaging 1.00
R7417:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7610:Alg11 UTSW 8 22065131 missense probably damaging 1.00
R8388:Alg11 UTSW 8 22062034 missense probably benign 0.03
X0019:Alg11 UTSW 8 22065424 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATCCTTGCACACAACTCAGG -3'
(R):5'- GAGAATGTTGCTCAGGCTGC -3'

Sequencing Primer
(F):5'- CAACTCAGGAGGCCCGAAG -3'
(R):5'- CTCAGGCTGCTTTGATTATGATAAAG -3'
Posted On2015-07-21