Mutagenetix > Incidental Mutations

Incidental Mutation 'R4447:Alg11'

328800

Institutional Source

Beutler Lab

Gene Symbol

Alg11

Ensembl Gene

ENSMUSG00000063362

Gene Name

asparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)

Synonyms

MMRRC Submission

041708-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4447 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22060721-22071627 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 22068079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 469 (A469E)

Ref Sequence

ENSEMBL: ENSMUSP00000072382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072572] [ENSMUST00000110737]

AlphaFold

Q3TZM9

Predicted Effect

probably benign
Transcript: ENSMUST00000072572
AA Change: A469E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000072382
Gene: ENSMUSG00000063362
AA Change: A469E

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:ALG11_N	62	269	2.6e-94	PFAM
Pfam:Glycos_transf_1	293	470	1.4e-30	PFAM
Pfam:Glyco_trans_1_4	301	454	8.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110737
AA Change: A427E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106365
Gene: ENSMUSG00000063362
AA Change: A427E

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
low complexity region	107	118	N/A	INTRINSIC
Pfam:Glycos_transf_1	248	428	3.8e-29	PFAM
Pfam:Glyco_trans_1_4	259	412	7.1e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131624

SMART Domains

Protein: ENSMUSP00000119161
Gene: ENSMUSG00000063362

Domain	Start	End	E-Value	Type
Pfam:ALG11_N	4	160	1.4e-60	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134474

Meta Mutation Damage Score

0.0769

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,198	T603A	probably benign	Het
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsf2	G	T	11: 94,569,359	P389Q	possibly damaging	Het
Aldh6a1	A	G	12: 84,439,709	V120A	possibly damaging	Het
Ankar	A	G	1: 72,687,789	S415P	possibly damaging	Het
Ano3	A	T	2: 110,761,578		probably null	Het
Asic4	A	T	1: 75,470,370		probably benign	Het
Atp1a4	A	C	1: 172,234,431	I709S	probably damaging	Het
Cyp11b2	T	C	15: 74,855,563	I90V	probably benign	Het
Fam129a	A	T	1: 151,636,402		probably null	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Irf5	T	A	6: 29,535,942	D318E	probably damaging	Het
Map2k3	A	T	11: 60,947,171	S253C	probably damaging	Het
Mgst1	G	T	6: 138,141,664		probably benign	Het
Mipol1	G	T	12: 57,352,748		probably benign	Het
Olfr371	T	A	8: 85,231,366	Y290*	probably null	Het
Pomgnt1	G	T	4: 116,152,923	V161L	possibly damaging	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Rxfp1	C	T	3: 79,652,127		probably benign	Het
Scn5a	T	C	9: 119,550,627	D197G	probably damaging	Het
Thsd7a	G	A	6: 12,324,635	T1479I	probably damaging	Het
Twsg1	C	T	17: 65,929,787	D83N	possibly damaging	Het
Ubqln3	C	T	7: 104,142,814	R23Q	probably benign	Het
Vmn1r228	T	C	17: 20,777,107	I50V	probably damaging	Het
Wnk4	T	A	11: 101,268,451	S565T	possibly damaging	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het
Zfp407	A	T	18: 84,562,694	V98D	possibly damaging	Het
Zfp598	T	A	17: 24,676,555	V73E	probably damaging	Het
Zscan29	T	A	2: 121,169,886		probably null	Het

Other mutations in Alg11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02612:Alg11	APN	8	22061983	missense	probably benign	0.22
1mM(1):Alg11	UTSW	8	22074057	missense	probably benign
R0240:Alg11	UTSW	8	22065452	missense	possibly damaging	0.83
R1908:Alg11	UTSW	8	22065568	missense	probably damaging	1.00
R1980:Alg11	UTSW	8	22061887	missense	possibly damaging	0.69
R2090:Alg11	UTSW	8	22065630	missense	possibly damaging	0.80
R2147:Alg11	UTSW	8	22065293	missense	probably damaging	1.00
R2159:Alg11	UTSW	8	22065845	missense	probably benign	0.44
R2265:Alg11	UTSW	8	22065614	missense	probably benign
R2760:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R2761:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R2762:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R2763:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R2764:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R2877:Alg11	UTSW	8	22065358	missense	possibly damaging	0.93
R4165:Alg11	UTSW	8	22065557	missense	probably damaging	1.00
R4230:Alg11	UTSW	8	22065518	missense	probably damaging	1.00
R4370:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R4371:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R4448:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R4450:Alg11	UTSW	8	22068079	missense	probably benign	0.00
R4840:Alg11	UTSW	8	22068010	missense	possibly damaging	0.91
R5859:Alg11	UTSW	8	22065841	missense	probably benign	0.10
R5988:Alg11	UTSW	8	22062028	missense	probably benign	0.00
R7293:Alg11	UTSW	8	22065379	missense	probably damaging	1.00
R7417:Alg11	UTSW	8	22062028	missense	probably benign	0.00
R7610:Alg11	UTSW	8	22065131	missense	probably damaging	1.00
R8388:Alg11	UTSW	8	22062034	missense	probably benign	0.03
R8708:Alg11	UTSW	8	22065113	missense	probably damaging	1.00
X0019:Alg11	UTSW	8	22065424	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- ATCCTTGCACACAACTCAGG -3'
(R):5'- GAGAATGTTGCTCAGGCTGC -3'

Sequencing Primer
(F):5'- CAACTCAGGAGGCCCGAAG -3'
(R):5'- CTCAGGCTGCTTTGATTATGATAAAG -3'

Posted On

2015-07-21