Mutagenetix > Incidental Mutations

Incidental Mutation 'R4447:Wwc2'

328801

Institutional Source

Beutler Lab

Gene Symbol

Wwc2

Ensembl Gene

ENSMUSG00000031563

Gene Name

WW, C2 and coiled-coil domain containing 2

Synonyms

D8Ertd594e

MMRRC Submission

041708-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R4447 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47823959-47990924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47868667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 471 (Y471H)

Ref Sequence

ENSEMBL: ENSMUSP00000056121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057561]

AlphaFold

Q6NXJ0

Predicted Effect

unknown
Transcript: ENSMUST00000057561
AA Change: Y471H

SMART Domains

Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563
AA Change: Y471H

Domain	Start	End	E-Value	Type
WW	11	43	3.92e-11	SMART
WW	58	90	4.65e-4	SMART
low complexity region	143	156	N/A	INTRINSIC
coiled coil region	162	194	N/A	INTRINSIC
coiled coil region	223	254	N/A	INTRINSIC
coiled coil region	302	333	N/A	INTRINSIC
low complexity region	341	358	N/A	INTRINSIC
coiled coil region	359	423	N/A	INTRINSIC
low complexity region	540	567	N/A	INTRINSIC
C2	713	818	5.29e0	SMART
coiled coil region	857	884	N/A	INTRINSIC
coiled coil region	1067	1144	N/A	INTRINSIC

Meta Mutation Damage Score

0.0675

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WW-and-C2-domain-containing family of proteins. Members of this family have two N-terminal WW domains that mediate binding to target proteins harboring L/PPxY motifs, an internal C2 domain for membrane association, and C-terminal alpha protein kinase C binding sites and class III PDZ domain-interaction motifs. Proteins of this family are able to form homo- and heterodimers and to modulate hippo pathway signaling. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,198	T603A	probably benign	Het
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsf2	G	T	11: 94,569,359	P389Q	possibly damaging	Het
Aldh6a1	A	G	12: 84,439,709	V120A	possibly damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Ankar	A	G	1: 72,687,789	S415P	possibly damaging	Het
Ano3	A	T	2: 110,761,578		probably null	Het
Asic4	A	T	1: 75,470,370		probably benign	Het
Atp1a4	A	C	1: 172,234,431	I709S	probably damaging	Het
Cyp11b2	T	C	15: 74,855,563	I90V	probably benign	Het
Fam129a	A	T	1: 151,636,402		probably null	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Irf5	T	A	6: 29,535,942	D318E	probably damaging	Het
Map2k3	A	T	11: 60,947,171	S253C	probably damaging	Het
Mgst1	G	T	6: 138,141,664		probably benign	Het
Mipol1	G	T	12: 57,352,748		probably benign	Het
Olfr371	T	A	8: 85,231,366	Y290*	probably null	Het
Pomgnt1	G	T	4: 116,152,923	V161L	possibly damaging	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Rxfp1	C	T	3: 79,652,127		probably benign	Het
Scn5a	T	C	9: 119,550,627	D197G	probably damaging	Het
Thsd7a	G	A	6: 12,324,635	T1479I	probably damaging	Het
Twsg1	C	T	17: 65,929,787	D83N	possibly damaging	Het
Ubqln3	C	T	7: 104,142,814	R23Q	probably benign	Het
Vmn1r228	T	C	17: 20,777,107	I50V	probably damaging	Het
Wnk4	T	A	11: 101,268,451	S565T	possibly damaging	Het
Zfp407	A	T	18: 84,562,694	V98D	possibly damaging	Het
Zfp598	T	A	17: 24,676,555	V73E	probably damaging	Het
Zscan29	T	A	2: 121,169,886		probably null	Het

Other mutations in Wwc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Wwc2	APN	8	47846158	missense	unknown
IGL01397:Wwc2	APN	8	47868276	missense	unknown
IGL01522:Wwc2	APN	8	47868633	missense	unknown
IGL01530:Wwc2	APN	8	47863939	missense	unknown
IGL01867:Wwc2	APN	8	47883580	missense	probably benign	0.02
IGL01991:Wwc2	APN	8	47869866	nonsense	probably null
IGL02092:Wwc2	APN	8	47864535	missense	unknown
IGL02320:Wwc2	APN	8	47863847	splice site	probably null
IGL02503:Wwc2	APN	8	47849383	missense	unknown
H8562:Wwc2	UTSW	8	47920666	missense	possibly damaging	0.77
R0244:Wwc2	UTSW	8	47900721	missense	probably benign	0.16
R0331:Wwc2	UTSW	8	47880204	missense	probably benign	0.15
R0349:Wwc2	UTSW	8	47868666	missense	unknown
R0542:Wwc2	UTSW	8	47868379	missense	unknown
R0645:Wwc2	UTSW	8	47900639	splice site	probably benign
R1081:Wwc2	UTSW	8	47828764	unclassified	probably benign
R1167:Wwc2	UTSW	8	47858779	nonsense	probably null
R1646:Wwc2	UTSW	8	47842902	missense	unknown
R1860:Wwc2	UTSW	8	47990102	missense	possibly damaging	0.90
R2070:Wwc2	UTSW	8	47868321	missense	unknown
R2183:Wwc2	UTSW	8	47842926	missense	unknown
R3969:Wwc2	UTSW	8	47856323	missense	unknown
R4096:Wwc2	UTSW	8	47842902	missense	unknown
R4387:Wwc2	UTSW	8	47831646	missense	unknown
R4448:Wwc2	UTSW	8	47868667	missense	unknown
R4450:Wwc2	UTSW	8	47868667	missense	unknown
R4646:Wwc2	UTSW	8	47920601	missense	probably damaging	1.00
R4869:Wwc2	UTSW	8	47920678	missense	probably damaging	0.99
R5159:Wwc2	UTSW	8	47900761	missense	probably benign	0.03
R5317:Wwc2	UTSW	8	47847555	missense	unknown
R5391:Wwc2	UTSW	8	47863871	missense	unknown
R5728:Wwc2	UTSW	8	47864061	missense	unknown
R5871:Wwc2	UTSW	8	47868423	missense	unknown
R5943:Wwc2	UTSW	8	47990102	missense	possibly damaging	0.90
R6137:Wwc2	UTSW	8	47856263	missense	unknown
R6169:Wwc2	UTSW	8	47858843	missense	unknown
R6363:Wwc2	UTSW	8	47887162	splice site	probably null
R6421:Wwc2	UTSW	8	47900746	missense	probably damaging	1.00
R6467:Wwc2	UTSW	8	47851908	missense	unknown
R6712:Wwc2	UTSW	8	47900803	missense	probably benign	0.42
R6765:Wwc2	UTSW	8	47900791	missense	possibly damaging	0.85
R6766:Wwc2	UTSW	8	47900791	missense	possibly damaging	0.85
R6767:Wwc2	UTSW	8	47900791	missense	possibly damaging	0.85
R6768:Wwc2	UTSW	8	47900791	missense	possibly damaging	0.85
R6782:Wwc2	UTSW	8	47900791	missense	possibly damaging	0.85
R6993:Wwc2	UTSW	8	47847465	missense	unknown
R7016:Wwc2	UTSW	8	47847548	missense	unknown
R7079:Wwc2	UTSW	8	47847545	missense	unknown
R7219:Wwc2	UTSW	8	47858884	missense	unknown
R7258:Wwc2	UTSW	8	47842999	missense	unknown
R7334:Wwc2	UTSW	8	47869794	missense	unknown
R7375:Wwc2	UTSW	8	47863920	missense	unknown
R7451:Wwc2	UTSW	8	47864575	missense	not run
R7505:Wwc2	UTSW	8	47880150	missense	probably damaging	0.96
R7825:Wwc2	UTSW	8	47990162	missense	probably damaging	1.00
R7854:Wwc2	UTSW	8	47868477	missense	unknown
R7904:Wwc2	UTSW	8	47856235	missense	unknown
R8811:Wwc2	UTSW	8	47883544	missense	possibly damaging	0.48
R8985:Wwc2	UTSW	8	47878884	missense	probably benign	0.09
R9004:Wwc2	UTSW	8	47920697	missense	probably damaging	0.99
R9133:Wwc2	UTSW	8	47851972	missense	unknown
R9339:Wwc2	UTSW	8	47900824	missense	probably damaging	1.00
Z1176:Wwc2	UTSW	8	47868549	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACAGGGATGCCACTGACTTG -3'
(R):5'- TCTGTGTTCCAGTAGAGACGTC -3'

Sequencing Primer
(F):5'- ATGCCACTGACTTGGAGGC -3'
(R):5'- AGACGTCCTCTGCCTGG -3'

Posted On

2015-07-21