Incidental Mutation 'R4447:Olfr371'
ID328803
Institutional Source Beutler Lab
Gene Symbol Olfr371
Ensembl Gene ENSMUSG00000051952
Gene Nameolfactory receptor 371
SynonymsGA_x6K02T2NUPS-13298842-13299780, MOR141-3
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85225988-85231509 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85231366 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 290 (Y290*)
Ref Sequence ENSEMBL: ENSMUSP00000151714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070849] [ENSMUST00000218663]
Predicted Effect probably null
Transcript: ENSMUST00000070849
AA Change: Y290*
SMART Domains Protein: ENSMUSP00000077921
Gene: ENSMUSG00000051952
AA Change: Y290*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.1e-55 PFAM
Pfam:7TM_GPCR_Srx 32 305 2.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.2e-8 PFAM
Pfam:7tm_1 41 290 9.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218663
AA Change: Y290*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Olfr371
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Olfr371 APN 8 85231184 missense probably benign 0.14
IGL01380:Olfr371 APN 8 85231329 missense possibly damaging 0.95
IGL01380:Olfr371 APN 8 85231146 missense probably damaging 0.99
IGL01680:Olfr371 APN 8 85230679 missense probably benign
IGL01880:Olfr371 APN 8 85231083 missense probably benign 0.00
IGL02194:Olfr371 APN 8 85230633 missense possibly damaging 0.82
IGL02416:Olfr371 APN 8 85231033 nonsense probably null
IGL02494:Olfr371 APN 8 85230683 missense possibly damaging 0.95
IGL03072:Olfr371 APN 8 85230510 missense probably benign 0.08
IGL03130:Olfr371 APN 8 85230629 missense possibly damaging 0.93
R0017:Olfr371 UTSW 8 85231077 missense probably benign 0.25
R1157:Olfr371 UTSW 8 85231260 missense probably damaging 0.98
R1165:Olfr371 UTSW 8 85230771 missense probably damaging 0.98
R1730:Olfr371 UTSW 8 85230848 missense probably benign 0.16
R2017:Olfr371 UTSW 8 85230744 missense possibly damaging 0.91
R2426:Olfr371 UTSW 8 85231064 missense probably damaging 0.97
R4703:Olfr371 UTSW 8 85230608 missense possibly damaging 0.95
R4797:Olfr371 UTSW 8 85230938 missense probably benign
R5029:Olfr371 UTSW 8 85231206 missense probably benign 0.00
R5173:Olfr371 UTSW 8 85230576 missense probably damaging 0.99
R6349:Olfr371 UTSW 8 85231158 missense possibly damaging 0.93
R7754:Olfr371 UTSW 8 85230798 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGCGGATTTCAACAGTGGG -3'
(R):5'- GTGTCTAGGAGGTCAAAACAAAGTC -3'

Sequencing Primer
(F):5'- GAGGAAAGTATAAAGCGTTTTCCACC -3'
(R):5'- AGGGCTGATACCTCAACTGTCAG -3'
Posted On2015-07-21